11.9 LAB: Course Grade Write a program that reads the student information from a tab separated values (tsv) file. The program then creates a text file that records the course grades of the students. Each row of the tsv file contains the Last Name, First Name, Midterm1 score, Midterm2 score, and the Final score of a student. A sample of the student information is provided in Studentinfo.tsv. Assume the number of students is at least 1 and at most 20. The program performs the following tasks: • Read the file name of the tsv file from the user. • Open the tsv file and read the student information. • Compute the average exam score of each student. Assign a letter grade to each student based on the average exam score in the following scale: o A: 90 =< x • B: 80 =< x < 90 • C: 70 =< x < 80

11.9 LAB: Course Grade Write a program that reads the student information from a tab separated values (tsv) file. The program then creates a text file that records the course grades of the students. Each row of the tsv file contains the Last Name, First Name, Midterm1 score, Midterm2 score, and the Final score of a student. A sample of the student information is provided in Studentinfo.tsv. Assume the number of students is at least 1 and at most 20. The program performs the following tasks: • Read the file name of the tsv file from the user. • Open the tsv file and read the student information. • Compute the average exam score of each student. Assign a letter grade to each student based on the average exam score in the following scale: o A: 90 =< x • B: 80 =< x < 90 • C: 70 =< x < 80

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: Pseudocode and Python Program Design Requirements Design the pseudocode and a Python program that…

A: This is simple programing questions , takong inputs , calculations and some output . Her is python…

Q: Ruby programming. What is the output of the given code? boolean_1 = 77<78 puts(boolean_1)

A: Ruby also supports Boolean i.e true false based on expression validity.

Q: Please help with creating the following in Java ToDo list with the following features The ability…

A: Algorithm: Define a ToDoList class with an ArrayList of ToDoItem objects as an instance variable.…

Q: how can I create comments in python?

A: In python, # character is used to start the single line comments. Place a hash symbol in front of a…

Q: Create a function which returns how many Friday 13ths there are in a given year. Examples howUnlucky…

A: function howUnlucky(y) { var counter = 0 for(let month = 0; month < 12; month++) { const date =…

Q: Which of these Python data types can have non-numeric indexes? Choose only one. 1) Group of answer…

A: Strings - can't have a non-numeric index Lists- can't have a non-numeric index Tuples- can't have a…

Q: gnment consists of three F# exercises. The code for all exercises are included in the single file,…

A: import array as arrelimDuplicates = arr.array('i',[1,2,2,3,3,3,4,4,4,4,5,5,5,5,5])val_it =…

Q: Programming Question Will you update the code using the instructions & code I provided. Please…

A: Program Approach: 1- As mentioned in the assignment implement the function as displayStats()…

Q: The idea of the Java servlets is exactly the same as in CGI programs, but the implementation is…

A: It is multithreading based i.e. It uses new thread for every new request. Hence multiple threads…

Q: How do I remove the 000000005 from the over budget when I run the program.

A: 1) Below is your updated program which format the result string into 2 decimal places 2) It uses…

Q: javascript please //20. function initPage //a. Dependencies: getUsers, populateSelectMenu //b.…

A: // #20 const initPage = async() => { let users = await getUsers(); let select =…

Q: Create a python computer program that has the user to input the highest temperature for each day of…

A: Hеrе is an algorithm for your program:Crеatе a list to storе thе tеmpеraturеs for еach day of thе…

Question

Python PLeaseee.

Ex: If the input of the program is:
StudentInfo.tsv
and the contents of Studentinfo.tsv are:
Barrett
Edan
70
45
59
Bradshaw
Reagan
96
97
88
Charlton
Caius
73
94
80
Mayo
Tyrese
88
61
36
Stern
Brenda
90
86
45
the file report.txt should contain:
Barrett
Edan
70
45
59
F
Bradshaw
Reagan
96
97
88
A
Charlton
Caius
73
94
80
B
Mayo
Tyrese
88
61
36
D
Stern
Brenda
90
86
45
Averages: midterml 83.40, midterm2 76.60, final 61.60

11.9 LAB: Course Grade
Write a program that reads the student information from a tab separated values (tsv) file. The program then creates a text file that records
the course grades of the students. Each row of the tsv file contains the Last Name, First Name, Midterm1 score, Midterm2 score, and the
Final score of a student. A sample of the student information is provided in Studentinfo.tsv. Assume the number of students is at least 1
and at most 20.
The program performs the following tasks:
• Read the file name of the tsv file from the user.
• Open the tsv file and read the student information.
Compute the average exam score of each student.
Assign a letter grade to each student based on the average exam score in the following scale:
• A: 90 =< x
• B: 80 =< x < 90
o C: 70 =< x < 80
• D: 60 =< x < 70
• F:x < 60
• Compute the average of each exam.
Output the last names, first names, exam scores, and letter grades of the students into a text file named report.txt. Output one
student per row and separate the values with a tab character.
• Output the average of each exam, with two digits after the decimal point, at the end of report.txt. Hint: Use the format specification to
set the precision of the output.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

dont post copied content posted multiple times
CS 386 Project: Overview Project Synopsis: This group project will require your group to design and implement your own enciphering algorithm. Your team's algorithm must combine the two operations, substitution and permutation/transposition, into your unique encryption algorithm. Your encryption algorithm must include multiple rounds of the two operations. You program must be able to encrypt and decrypt messages. Your team will need to give your algorithm a name that is unique to your encryption technique. Your group may
Coding in python Please!!I need help please help me in the easiest way to do this coding question. Please do not post it's answer from chegg just use your own skills to write code in easyiest way possible. I will really appriciate your help. Coding language PYTHON : The purpose of this assignment is to help you get comfortable creating and using simple classes and objects. In this assignment, we wish to model a 2-D video game character’s movements. In particular, suppose we are creating a tiny game, where the character can occupy one of 25 squares, like so: The first thing we need to keep track of is the character’s name, so we can differentiate this character from other characters or enemies. The other thing we need to keep track of is the character’s position, i.e., which square they are in. In order to do this, we’ll use an X-Y coordinate system with the origin in the top left corner (the 0,0 square in the picture). So, in the picture, the character occupies square 3, 2;…
Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…
Write a program that accepts two four-digit binary numbers, converts them to decimal values, adds them together, and prints both the decimal values and the result of the addition. Requirements: Functionality. (80pts) No Syntax Errors. (80pts*) *Code that cannot be compiled due to syntax errors is nonfunctional code and will receive no points for this entire section. Clear and Easy-To-Use Interface. (10pts) Users should easily understand what the program does and how to use it. Users should be prompted for input and should be able to enter data easily. Users should be presented with output after major functions, operations, or calculations. All the above must apply for full credit. Users must be able to enter a 4-bit binary number in some way. (10pts) No error checking is needed here and you may assume that users will only enter 0’s and 1’s, and they will only enter 4 bits. Binary to Decimal Conversion (50pts) You may assume that users will only give numbers that add up to…
fast in python thanks
WriteindetailaboutOSstructure