11.9 LAB: Course Grade Write a program that reads the student information from a tab separated values (tsv) file. The program then creates a text file that records the course grades of the students. Each row of the tsv file contains the Last Name, First Name, Midterm1 score, Midterm2 score, and the Final score of a student. A sample of the student information is provided in Studentinfo.tsv. Assume the number of students is at least 1 and at most 20. The program performs the following tasks: • Read the file name of the tsv file from the user. • Open the tsv file and read the student information. • Compute the average exam score of each student. Assign a letter grade to each student based on the average exam score in the following scale: o A: 90 =< x • B: 80 =< x < 90 • C: 70 =< x < 80

11.9 LAB: Course Grade Write a program that reads the student information from a tab separated values (tsv) file. The program then creates a text file that records the course grades of the students. Each row of the tsv file contains the Last Name, First Name, Midterm1 score, Midterm2 score, and the Final score of a student. A sample of the student information is provided in Studentinfo.tsv. Assume the number of students is at least 1 and at most 20. The program performs the following tasks: • Read the file name of the tsv file from the user. • Open the tsv file and read the student information. • Compute the average exam score of each student. Assign a letter grade to each student based on the average exam score in the following scale: o A: 90 =< x • B: 80 =< x < 90 • C: 70 =< x < 80

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

dont post copied content posted multiple times
Create the parse csv python function to parse csv (comma separated values) files. ?
CS 386 Project: Overview Project Synopsis: This group project will require your group to design and implement your own enciphering algorithm. Your team's algorithm must combine the two operations, substitution and permutation/transposition, into your unique encryption algorithm. Your encryption algorithm must include multiple rounds of the two operations. You program must be able to encrypt and decrypt messages. Your team will need to give your algorithm a name that is unique to your encryption technique. Your group may
Coding in python Please!!I need help please help me in the easiest way to do this coding question. Please do not post it's answer from chegg just use your own skills to write code in easyiest way possible. I will really appriciate your help. Coding language PYTHON : The purpose of this assignment is to help you get comfortable creating and using simple classes and objects. In this assignment, we wish to model a 2-D video game character’s movements. In particular, suppose we are creating a tiny game, where the character can occupy one of 25 squares, like so: The first thing we need to keep track of is the character’s name, so we can differentiate this character from other characters or enemies. The other thing we need to keep track of is the character’s position, i.e., which square they are in. In order to do this, we’ll use an X-Y coordinate system with the origin in the top left corner (the 0,0 square in the picture). So, in the picture, the character occupies square 3, 2;…
Explain an example of executable statement.
Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…
None
Answer as soon as possible please Web Programming Question Create a complete PHP application with two (2) input fields to input five (5) username and its password into an MyUser [] array using adduser() function and a submit button using post method. Display the contents of the MyUser[] array after all the inputs.
Write a program that accepts two four-digit binary numbers, converts them to decimal values, adds them together, and prints both the decimal values and the result of the addition. Requirements: Functionality. (80pts) No Syntax Errors. (80pts*) *Code that cannot be compiled due to syntax errors is nonfunctional code and will receive no points for this entire section. Clear and Easy-To-Use Interface. (10pts) Users should easily understand what the program does and how to use it. Users should be prompted for input and should be able to enter data easily. Users should be presented with output after major functions, operations, or calculations. All the above must apply for full credit. Users must be able to enter a 4-bit binary number in some way. (10pts) No error checking is needed here and you may assume that users will only enter 0’s and 1’s, and they will only enter 4 bits. Binary to Decimal Conversion (50pts) You may assume that users will only give numbers that add up to…
what is Windows Form object ?
fast in python thanks
370f7da64_Major Assignments - Microsoft Word References Mailings Review View 11 -A A Aa =,三, 词烈 AaBbCcDc AaBbCcDc AaBbC AaBbCC = x, x A- aby - A - I Normal T No Spaci. Heading 1 Heading 2 Font Paragraph Styles Write C++ programs on BANKING SYSTEM has account class with data members like account number, name,deposit, withdraw amount and type of account. Customer data is stored in a binary file. A customer can deposite and withdraw amount in his account. User can create, modify and delete account. In this banking system project, Do not used graphics to keep program simple. | MAIN MENU 81. NEV ACCOUNT 82. DEPOSIT AMOUNT BANK 83. VITHDRAV AMOUNT 4. BALANCE ENQUIRY MANAGEMENT Bs. ALL ACCOUNT HOLDER LIST SYSTEM 06. CLOSE AN ACCOUNT 87. MODIPY AN ACCOUNT 08. EXIT Select Your Opt ion (1-8> - KEM ACCOUMT ENTRY PORM ACCOUNI TRANSCATION PORH--- Enter The account Hunber: 106 Enter The Hane of The account Holder : SKREYA Enter The acceunt No. : 106 Enter Type of The account (CA)IS -ACCOUNT STATUS-…