1.Which of the following molecules consist of a chain of amino acids? Select all that apply. A. Carbohydrates B. Proteins C. Nucleic acids D. Lipids 2.Isotopes are variations of the same element that differ in their number of…. A. protons B. polymers C. electrons D. neutrons
Q: Part Three: Metabolism: Your cells are going to USE the food they've been provided! Describe the…
A: Metabolism is the chemical reactions occurs in our body which changes the food into energy to run…
Q: Different breeds of Korean cattle produce meat with varying amounts of stearic, linoleic and oleic…
A: Fatty acid synthase (FAS) is a large multifunctional enzyme that is responsible for the synthesis of…
Q: TPI deficiency is a rare human condition. Patients who lack TPI cannot convert the triose…
A: Glycolysis is the metabolic pathway that converts 1 molecule of glucose to 2 molecules of pyruvate…
Q: sucrose + lactase being combined was meant to demonstrate 1. enzymes are specific to their…
A: Enzymes are biocatalyts which are generally protein in nature except ribozyme. Sucrose is a…
Q: It is a pyrimidine derivative that does not form part of nucleic acids.... A) Thymine B) Cytosine C)…
A: Nucleotides are the building blocks of nucleic acids. They are phosphoric acid esters of…
Q: Identify the principle (what amino acid/s it detects and the general reaction), the reagents used,…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand,…
A: Amino acids - are building blocks of proteins and alpha carbon of amino acids contains amine group,…
Q: Consider the reaction below. Where would the labelled carbon (represented by the asterisk * in the…
A: As you can see the reactant side is undergoing the reaction where there is removal of CO2 and NADP+…
Q: For the study of alanine production by a recombinant strain of E. coli, cultivation was carried out…
A: A recombinant strain is a type of genetically modified organism (GMO) that has been artificially…
Q: 27. Match the following three words to its correct definition. a.) Transformation b.) Transduction…
A: The horizontal gene transfer is the process of transfer of DNA from one organisms to another without…
Q: Name of Enzyme Class Number of Enzyme Reaction Catalysed Hexokinase Phosphorylates glucose…
A: Glycolysis is a pathway that converts glucose molecules into energy by breaking into pyruvate…
Q: 1. Amino Acid 1 = W + X = Draw amino acid 1 at a low pH a) As the D Fisher Projection Name of amino…
A: Amino acids are organic compounds that contain an amino group (-NH2) and a carboxylic acid group…
Q: 7. You have a 200 mg/mL stock solution of protein. To make 20mL of 5mg/mL solution, add of stock and…
A: Dilution results in a decrease in the concentration of a substance in a mixture. A stock solution is…
Q: I'd like you to explain to me the structure of one of your macromolecules. You should be describing…
A: Bio molecules or biological molecules that are formed in the body of living organisms. These are…
Q: What is test for carbohydrates and why is it important?
A: Introduction. There are four different types of biomolecules present in our body, carbohydrate,…
Q: Optional) Describe the structure of DNA, discussing the DNA helix and the base pairs of ONA, the…
A: Introducion There are two types of nucleic acid present in our body. DNA and RNA. DNA acts as a…
Q: what is the dna concentration suspended in PO4 buffer at ph 7.0 that has an absorbance at 260 nm…
A: DNA concentration of a sample can be determined using spectrophotometry and measuring the absorbance…
Q: How to control or take care of microbial metabolism?
A: Microbial metabolism is the pathway followed by microorganisms to obtain the energy (carbon source)…
Q: When the enzyme is incubated with iodoacetate, it is observed that glyceraldehyde-3- phosphate still…
A: Enzymes are made up of amino acids, and the sequence as well as the arrangement of those amino acids…
Q: If you are a medical technologist, which of the four methods of glucose determination would you…
A: Determination of glucose level in blood and urine helps us to diagnose diabetes and many other…
Q: 1. 5.5µg/mL 2. 750mL 3. 29μµL 4. 1.55g 5. 0.045mg 6. 9.5mg/L 7. 850g 8. 3.5 x 10 mL 9. 4.50 x…
A: The numbers that are too large or too small are written in decimal form. This method of expressing a…
Q: Which of the following is NOT a true statement about the diagram below? Intermediate A Pathway…
A: Enzymes are the biocatalysts that mediate the biochemical reactions of metabolic pathways. They have…
Q: Lineweaver-Burk plot determined an equation for the trendline linear curve fit to be y = 4.20 x +…
A: The line weaver burk plot is a double reciprocal plot, i.e., it is the graph for 1V vs 1[S], where V…
Q: Describe a two-step purification procedure that could be used to purify/isolate protein A from the…
A: Chromatography is a laboratory technique used to separate mixtures of different components. It works…
Q: The active site residues in some proteins seem to be "ultimately conserved," meaning that any change…
A: 2 evolutionary distant organisms, like a fungi and a human could still share a common gene between…
Q: 7) The following are a product of the ester hydrolysis of a lipid which contains three esters.…
A: Simple lipids are esters of fatty acids with glycerol, i.e. it forms ester bond with alcohol,…
Q: 10. Assume you have the following stock solutions: 10% sodium dodecyl sulphate (SDS) V'S M NaOH…
A: Dilutions of any solutions can be calculated using the formula: C1V1 = C2V2 Where, C1= concentration…
Q: 4. At pH 9.5, what is the net charge of the peptide LTDQRHGE?
A: Peptide is composed of polymer of amino acids (length of 13 to 17 amino acids) which is linked by…
Q: Cell communication review
A: Cell communication refers to the process by which cells interact with each other to coordinate their…
Q: 5 For the peptide structure in #3, (ASP-ALA-THR-LYS-GLY), use the chart at the end of this HW set…
A: The proteins are composed of twenty naturally occurring amino acids. The amino acids can be…
Q: CHOOSE THE ANSWER FROM THE FOLLOWING CHOICES: Phosphodiester Bond Glycosidic Bond Ester…
A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Nucleic acids…
Q: Which energy system did you use for a vertical one-clap pushup or pushup? (Choose one) A) ATP-PC…
A: Answer ATP-PC system Explanation The ATP-PC system, also known as the phosphagen system, is the…
Q: 3. Look at the label for Lindt chocolate bar below. a. Does this product contain animal fat? How…
A: (a)Plants and Animals have quite a difference in theor metabolic pathways. As a result of which…
Q: Table 9.2 shows that Go’ for the aldolase reaction is large, and positive, yet the reaction…
A: Aldolase are class of enzyme that performs an aldol reaction (formation of an aldol) or its reverse…
Q: An enzyme facilitate catalysis by formation of phosphoester bond with the phosphate group of the…
A: Enzymes are biomolecules which facilitate key biochemical reactions by acting as catalysts. The…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: We need a string-matching-based approach to identifying protein homologies between several proteins.…
A: String-matching-based approaches to identifying protein homologies involve comparing the sequences…
Q: a. Draw out the pathways described above. Provide accurate line drawings for each lipid described b.…
A:
Q: Tyrosine is considered to be non-essential in the diet. Please explain what that means and what…
A: Proteins are made up of molecules called amino acids. Proteins and amino acids are the components of…
Q: 1. Biochemical mechanisms of fatty acids and glycerol mobilization. 2. Metabolism of glycerol,…
A: Triglycerides are fatty acid esters of glycerol, where three fatty acid molecules are linked to one…
Q: Discuss briefly the role of (a) 10% hydrochloric acid (b) 10% Na2CO3, and (c) anhydrous Na2SO4 in…
A: Alkaloids are a diverse group of naturally occurring compounds that are produced by plants, fungi,…
Q: 5. The amino acid sequences of three peptide fragments are shown below. Peptide 1: QAMGRAGDLKYLGLHSV…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: What is an engineered plasmid used for? What are the important features of\ engineered plasmids?
A: Engineered plasmids are powerful tools that allow researchers to manipulate DNA sequences and study…
Q: 4. What are the ABSORBABLE units of EACH of the FOUR Biological Molecules (Macromolecules) called?…
A: Macromolecules are large complex molecules which is formed from the polymerization of thousand of…
Q: 1.b)Which one of the following would produce the most reliable evidence? in vitro study case report…
A: There are several different types of study designs that are used to gather evidence, each with its…
Q: For the enzyme reaction mechanism with an inhibitor that produces product from both ES and EIS, E +…
A: Enzymes are proteins that act as catalysts to speed up biochemical reactions in living organisms.…
Q: True and false - A k+ channel will be just as permeable to Na+ as to K+ because Na+ is a smaller ion…
A: Ion channels are proteins that form pores in the plasma membrane and allow ions to pass through in…
Q: 9. Briefly describe and draw the structure of the following disaccharides in their ring structure.…
A: A. Sucrose structure: O O| || || |O-C-O-C-H H-C-O-C-O| || || |H H B. Maltose structure: O O| || ||…
Q: Draw and give the name of the following lipid compounds: A. a saturated fatty acid with 18 carbons…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…
A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…
Amino acids - alpha carbon of amino acids contains amine group, carboxyl group and side chain group. Based on the side chain group of amino acids, it can be charged polar, uncharged polar and non-polar. number of amino acids exist in nature but 22 amino acids are coded by genetic code and 20 common amino acids are present. Carboxyl group of amino acid 1 linked with amine group of amino acid 2 by peptide/amide bond with release of water molecule.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. Carbohydrates a. Are only ketoses b. Have one carboxyl group C. Serve as a fuel d. Are only polysaccharides 2. Lipids: a. Are Hydrophilic b. Contains monomers c. Are divided into 3 types d. Phospholipids can function as signaling molecules 3. Proteins: a. Function depends on the structure b. Monomers are the nucleotides c. Can be denatured by physical and chemical changes d. Tertiary structure has Vander Waals interactions formed between R groups of amino acids 4. Nucleic acids: a. Are polymers of nucleotides b. DNA and RNA are the same c. DNA contains URACIL base d. RNA is a double helix B- True or False: 1) Genes consist of DNA which belongs to the class of nucleic acids 2) The process of hydrogenating vegetable produces only saturated fats 3) The monomers of proteins are nucleotides 4) Phospholipids are formed by 1 glycerol and 3 fatty acids 5) Unsaturated fats contain 1 or more double bonds between carbon atoms2. Lipids: a. Are Hydrophilic b. Contains monomers c. Are divided into 3 types d. Phospholipids can function as signaling molecules 3. Proteins: a. Function depends on the structure b. Monomers are the nucleotides c. Can be denatured by physical and chemical changes d. Tertiary structure has Vander Waals interactions formed between R groups of amino acids 4. Nucleic acids: a. Are polymers of nucleotides b. DNA and RNA are the same c. DNA contains URACIL base d. RNA is a double helixWhich of the following is not a function of proteins? a. transport molecules b. acting as messengers c. supports the structure d. store genetic information What monomers join to form polypeptides? a. fatty acids b. nucleotides c. amino acids d. monosaccharides Which of the following is NOT a basic component of every amino acid? a. R group b. Amino group c. Carboxyl group d. Hydroxyl group What chemical bond links the amino group of one amino acid to the carboxyl group of the other? a. Ionic bond b. Peptide bond c. Covalent bond d. Hydrogen bond
- Choose the correct macromolecule that corresponds to the characteristics below. a = nucleic acids lipids b = carbohydrates c = proteins d = e = all 1. Functions include insulation and energy storage. 2. Subunits are simple sugars. 3. Used as a quick source of food energy. 4. Enzymes are an example. 5. Elements present are C, H, O & N. 6. Subunits are nucleotides. 7. Held together by peptide bonds 8. Examples include oils, waxes, and fats 9. Subunits are glycerol and 3 fatty acids 10. Is an organic compound. 11. Includes DNA & RNA. 12. Examples include sugars and starches. 13. Elements present are C, H, O, N, & P. 14. Is coded for by DNA. 15. Made of amino acid subunits. 16. Ratio of C:H:O is 1:2:1. 17. Functions as structure of hair and nails. 18. Contains an organism's information in a code. 19. Contains the most energy per gram 20. Includes cellulose cell walls in plants. 21. Elements present are C, H, and a small amount of O. 22. Includes glycogen for energy storage in mammals. 23.…match each type of molecule with its characteristics: a. starch b. glycogen c. fat d. nucleotide i. stores energy in plants ii. consists of a pentose sugar, phosphate, and nitrogenous base iii. 3 fatty acids attached to a glycerol iv. a branched polysaccharide in animals select one: a. a-i, b-iii, c-ii, d-iv b. a-i, b-iv, c-iii, d-ii c. a-iii, b-iv, c-iii, d-i d. a-ii, b-iv, c-iii, d-i e. a-iv, b-i, c-ii, d-iiiThe monomers of proteins are __________, and these are linked bypolar covalent bonds commonly referred to as _______________.a. nucleotides, peptide bondsb. amino acids, ester bondsc. hydroxyl groups, ester bondsd. amino acids, peptide bondse. monosaccharides, glycosidic linkages
- Which of the following statements is a characteristic of a monomer ? a. Larger molecules that are chains of monomers b. Complex carbohydrates, lipids, proteins, and nucleic acids c. May be split and used for energy d. Simple sugars, fatty acids, amino acids, and nucleotides1.Functional groups can be defined as:* a. specific substituents or moieties within molecules b. collection of atoms that attach the carbon skeleton of an organic molecule c. both A and B d. neither A nor B 2. Vitamin E is miscible with hexane. Based on this observation, it can be inferred that__________* Vitamin E is polar and can be classified as lipid Vitamin E is non-polar and can be classified as lipid Vitamin E is amphipathic and cannot be classified as lipid Vitamin E is neither polar or non-polar and cannot be classified as lipid 3. Positive with Molisch Test and Benedict Test but negative with both Iodine Test and Seliwanoff's Test, immediate precipitate formation with Barfoed's Test, and muddy brown coloration with Bial's Test.* Glucose Fructose Ribose/Arabinose Maltose SucroseWhich of the following describes a lipid? A. An organic molecule that consists of one or more chains of amino acids folded up in a specific shape B. A fatty, oily, or waxy organic compound often composed of fatty acids C. A molecule that consists primarily of carbon, hydrogen, and oxygen atoms in a ratio of 1:2:1 D. A molecule that consists of one or more strands of nucleotides
- Which of the following statement(s) about proteins is true? a. proteins are polymers of amino acids chemically joined by dipeptide bondsb. proteins have 4 functional levelsc. proteins can be irreversibly denaturedd. fibrous proteins are functional and globular proteins are structurale. none of the aboveMacromolecules Carbohydrates Proteins Lipids Nucleic Acids ii. iii. Function To provide energy, store energy, build macromolecules, and spare protein iv. Monomer b. For each of the following scenarios explain which macromolecules are being described: CHOICES: Lipid, Carbohydrates, Protein, or Nucleic Acid i. Oxygen is transported through your blood using a substance called hemoglobin. Monosaccharide DNA is opened to be copied onto mRNA during transcription. Glucose is broken down during glycolysis to create pyruvate. Shape A waxy cuticle on the top surface of leaves helps to repel water.3. Proteins: a. Function depends on the structure b. Monomers are the nucleotides c. Can be denatured by physical and chemical changes d. Tertiary structure has Vander Waals interactions formed between R groups of arnino acids 4. Nucleic acids: a. Are polymers of nucleotides b. DNA and RNA are the same c. DNA contains URACIL base d. RNA is a double helix