1. Measure the diameter of the hole in a 5 yen coin. 2. Try changing the distance between the eye and the coin so that the size of the moon and the hole in the coin are approximately the same. Thole 5 yen coin Dhole Moon = 3.8x105km DMoon rMoon 3. Calculate the moon's diameter using the following formula. = DMoon Dhole rhole Moon

Q: Question 2 How are fluvial processes geomorphological? Water is transported underground so you do…

A: How are fluvial processes geomorphological? Answer: option 3. Water transports rock material to…

Q: Look over the region and examine the mountains, note their shape, ground cover, and height. Then…

A: How do the Shenandoah Mountains compare to the Rocky Mountains?Answer: Option (d) All of the…

Q: The photospheres of red giant stars have the same temperature as those of red dwarf stars. However,…

A: Option A Red giants have a much larger radius, and luminosity depends on both temperature and…

Q: If an earthquake is 6000 times as intense as a 0-level earthquake, what is the Richter Scale ranking…

A: Richter Scale Ranking (R): ‘I0’ is the magnitude of a perceptible earthquake. And ‘I’ represent the…

Q: can we get rid of the plastic waste accumulated from covid pandemic in the united states? Write in…

A: Plastic waste: Plastic wastes are the plastic objects like plastic bottles, plastic covers, and…

Q: How did Copernicus account for the sometimes backwards motion of Mars? Select the best answer O…

A: Introduction Kepler and Copernicus talked about the motion of the planets and such type of motion is…

Q: You measure the spectrum of a distant galaxy and determine that the redshift is z = 9.75. How many…

A: The cosmological redshift - The stretching of light as the space expands. it is the wavelength…

Q: Complete the sentence Starting as asteroid, we then call it [Select] [ Select] the ground. when it…

A: The asteroids are the belt in between the Mars and Jupiter. They are primitive in our solar system.…

Q: Endosymbiosis is when one symbiotic organism Ofeeds on Olives inside controls digests the other.

A: Answer) Endosymbiosis is an example of symbiotic relationship in which larger organism is host and…

Q: letter "A" can best be identified as:

A: A river is a naturally flowing body of freshwater that flows towards the lake, ocean, sea, or…

Q: xplanation please

A: A meander is any of a number of predictable, sinuous arcs that run along a river or other…

Q: #2 TACCCCTCTAATGACAGTACT TRANSCRIPTION mRNA: Protein (amino acid sequence): TRANSLATION

A: The RNA TO mRNA follow this sequence A to U. C to G. T to A.

Q: 44. There is evidence that significant perturbations of the climate system can result in changes…

A: Option A Snowball Earth Explanation: The Snowball Earth speculation suggests that, during at least…

Q: on timescales of years to seasons, the primary effect of volcanos on climate is changes in albedo…

A: Volcanic eruptions cause flow of gases including greenhouse gases, water vapor, solid rock pieces,…

Q: You see an igneous rock next to a sandstone, and notice that the sandstone appears discolored and a…

A: The 4th option, "The sandstone is older" is most likely to be a correct interpretation

Q: All minerals are

A: A mineral is a homogenous solid that is either made of a single native element or two more…

Q: Task 1 - Part D, Q1 Part D Next, you'll use your spreadsheet to create a graph. The graph will help…

A: A pie charr is a graphical portrayal method that shows information in a round formed chart. A…

Q: Question 3 How do you distinguish a rock from a mineral? Audio 0:00/0:22 A B C «» С Speed: 1x…

A: 3. Minerals are natural substances, which are consisted of elements. These have definite crystal…

Q: An endosymbiotic relationship is considered facultative. True False

A:

Q: T Thesaurus.com A Canvas DiClicker Pearson+ Cengage P Pearson w Geography Ebook In the above image,…

A: Glaciers are eroded and transported forming 'u' shape valleys. The glacier which are deposited in…

Q: Which of the following proxies can be used to study temperatures on Earth for approximately the past…

A:

Q: What are emissions are from a tonne of co2?

A: The Sun's radiation warms of the Earth's surface. The heated surface of the Earth radiates this heat…

Q: How Cirques and Horns glaciers connected?

A: Glaciers are huge, thick and down slope moving bodies of Ice. It moves under the influence of…

Q: What type of unconformity is this? @McGraw-Hill Education Multiple Choice O nonconformity…

A: INTRODUCTION :  A nonconformity exists between sedimentary rocks and metamorphic or igneous…

Q: At various times since the 1950s, scientists in the UK and Canada have been involved in computerized…

A: The most important information that could be obtained from the tagging programs like the ones that…

Q: You have decided that a comfortable retirement means drawing $50,000 (in 2019 dollars) from your…

A:

Q: ss at least three ways you can decrease your impact on the environment.

A: Environmental impact: Any change to the environment whether beneficial or adverse is known by the…

Q: What is the correct relationship between an upper trough and a surface low pressure center in the…

A: Answer: the upper trough is directly above the surface low is correct answer. The correct…

Q: What type of unconformity is this? @McGraw-Hill Education Multiple Choice O O nonconformity angular…

A: A break in the stratigraphic succession is unconfirmity.Unconformity exhibits the following…

Q: As discussed in lecture, mutualisms have been used in all of the following examples EXCEPT which?…

A: Mutualism is an interrelationship between two species that becomes useful or beneficial for both.

Q: At a regional scale in the state of Oregon, dry climate conditions can be found on the east side of…

A: 2. Elevation and sloping play a crucial role to understand the vegetation at local level in case of…

Q: Which of the following occurred as a result of the arrival of abundant levels of oxygen in Earth's…

A: Anaerobic metabolism occurs in the absence of oxygen. Photosynthesis occurs in the presence of…

Q: If s is a position function, determine what s(5) – s(4) represents. a. instantaneous velocity at t =…

A: 5. The position function indicates an object's position at a particular point in time. Velocity of…

Q: Humans are environmental agents of change by influencing the disturbances. Magnitude Frequency…

A: Magnitude refers to immensity the extent of anything concerned.  Frequency denotes the repetition of…

Q: Why are these two questions False? Explain in a short answer. In the Arctic Circle, the average…

A: In the arctic circle, the average seasonal temperature is raised not only because in summer you are…

Q: Which of the following statements is accurate about minerals? Select all that apply.

A: Minerals: Minerals are the naturally occurring inorganic element or compound having an arranged…

Q: If you had only a trace element REE plot and an Nd vs. Sr isotope plot, NOT A ROCK, could you tell…

A: While andesite makes up some volcanic mountains, basalt is primarily found in the oceanic crust.…

Q: In a mycorrhizal relationship, the fungi largely provides: carbon glucose nutrients sugar

A: Answer : option 3. Nutrients is correct answer. In a mycorrhizal relationship or symbiotic…