1. Identify the type of fault that creates Horsts and Grabens, and explain the difference between these two types of landforms?

Q: 0.09 How many in the population are homozygous dominant? How many people have wet ear wax (This is…

A: Hardy Weinberg Equilibrium or HWE states that the frequency of occurrence of specific alleles in a…

Q: 17 Match the number of the label in the diagram below with the appropriate site or structure from…

A: Electron transport chain Also called the ETC is composed of four protein complexes. These protein…

Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…

A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…

Q: Part 1: Graphing Biotic Potential 1. Make a table to show the data (# flies/generation). for one…

A: Given that one female fly can produce 120 eggs in one generation. Of these 120 eggs, half (60) will…

Q: A biologist gathered data to show the interaction of the golden-cheeked warbler and juniper tree…

A: It is given that the bar colored in light grey gives the number of juniper tree person acre and the…

Q: How would the immediate loss of ATP likely influence the delivery of uncoated vesicles to their…

A: Answer of the question is option "C" Vesicle transport is the way of transport protein in…

Q: Please read the prompt and answer question 4 and answer ALL its subquestions. Please mind the word…

A: The breakdown of the large food molecules which are insoluble into water soluble food molecules to…

Q: Q1.32. In the terrestrial phosphorus cycle illustrated below, at what rate is the size of the plant…

A: Phosphorous is introduced into soil by the weathering of rocks. The soluble phosphorous is then…

Q: 22) If both married couples have the sickle cell trait (AS), what is the possible combination of…

A: The mode of inheritance is a pattern of obtaining parentral alleles  or genes to the offsprings. The…

Q: Punnett Square a What is the percent chance the offspring will be green? 0% Gg 100% 99 25% Privacy…

A: A Punnett square is a graph that makes it simple to ascertain the anticipated proportion of various…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: When you examine the phenotype of wings - why can you conclude that wings & flight are analogous…

A: Change in visible characteristics of an organism which takes place from many generations is called…

Q: According to the videos and the readings for this unit, what is true of the gut microbiome? The gut…

A: Gut microbiome are the microbiota (range of bacteria, archea and fungi ) that lives inside the gut…

Q: 5)(comprehension) In double-stranded DNA, which of the following base RATIOS ALWAYS EQUALS 1?…

A: Erwin Chargaff proposed two rules which are termed as Chargaff's rule. These rules played an…

Q: Which procedure should have been performed to prevent error in this investigation?

A: The correct answer is d, Both groups should have been tested in the same soil type at each humidity…

Q: Organ Lymph nodes Tonsils 4. Thymus along the course of the lymphatic vessels 2. 5. 6. Location…

A: As per Bartleby guidelines, an expert cannot answer more questions at a time. So, kindly post other…

Q: The pKa of the HEPES buffer is 7.55. What is its effective buffering range? Any pH below 7.55 Any pH…

A: HEPES means hydroxyethyl-piperazineethane sulfonic acid. Buffers are the solutions that resist the…

Q: 4)In 2018, the atmospheric concentration of CO2 was 408 pm, and the concentration of methane was…

A: Parts per billion (ppb) is a unit of measurement used to express the concentration of a substance in…

Q: Examine the table showing the classification of four questions. Taxon Domain Kingdom Phylum Class…

A: Classification is the process of grouping things together based on shared characteristics. In…

Q: 1. =lemg/ The order is for 200 mg. The label reads 250 mg/5ml. You would give ml The order is for…

A: Given: Order for 200 mg, Label: 250 mg/5ml. To Find: Amount in ml.Given: Order for 500 mg, Label: 1…

Q: The Kudzu plant is an invasive species because: O It is native to East Asia but currently is found…

A: Introduction: Kudzu (also Known As Japanese Arrowroot Or Chinese Arrowroot) Is A Perennial Vine That…

Q: nswer any three.

A: As we know Hemoglobin is a product made from heme+globin. The presence of heme gives the red color…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: | 11. Fill in the correct answers below. e. A specific example of a carbohydrate monomer is: ANSWER…

A: Macromolecules are large, substances made up of repeating components such as carbohydrates, lipids,…

Q: • At a pH of 12, what charged groups are present in the amino acid valine? -NH3+ -CO2- -NH2- -NH3+…

A: Aminoacids are the building blocks of protein. Each aminoacid have a central carbon and it's…

Q: 8. In the Stomach: a. Is there digestion? YES or NO b. If YES, then answer i-iv to explain. If NO,…

A: Fats are esters of fatty acids , also called as lipids/triglycerides.

Q: Identify the structures that are part of the male reproductive system. Select 2 choice(s) vas…

A: The male reproductive system includes- Penis, scrotum, testes, epididymis, vas deferens, prostrate…

Q: age) contain primarily protein and reen peppers and onions) contain

A: The breakdown of the large food molecules which are insoluble into water soluble food molecules to…

Q: Y-: yellow yy: black S-: star ss: starless All the sneetches want their children to have stars on…

A: Available data: Two autosomal diallelic genes Y and S Y is the dominant allele which expresses for…

Q: 1. Divide orchiopexy into its two word parts and give the meaning of each word part. Meaning Word…

A: Orchiopexy: The undescended testicles do not cause pain, but they may cause swelling or a lump in…

Q: - After you are finished, list each step for the Gram staining procedure. - Which of the four steps…

A: NOTE: AS PER OUR GUIDELINES WE NEED TO ONLY ATTEMPT FIRST QUESTION AND ITS PARTS , PLEASE RESUBMIT…

Q: 2. (A) What is the name of the key orexigenic neurons in the arcuate nucleus ARC. (B) These neurons…

A: The central nervous system (CNS) is one of the two major divisions of the nervous system. It…

Q: Digestion of the cheese and meat FATS: 7. In the Mouth: a. Is there digestion? YES or NO b. If YES,…

A: 7) (a) No, digestion of fats doesn't take place in the buccal cavity. In the mouth only the…

Q: Which of the following is not true of diabetic retinopathy? retina blood vessels swell blood glucose…

A: Answer 1 Option C is correct :  Higher than normal HDL cholestrol levels

Q: 1. Gene expression can be regulated at the level of a) transcription b) RNA stability c) translation…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: 10. Name which system each organ belongs to: Organ Organ System Name something you know about this…

A: The organisms exhibiting metabolism, cellular organisation, homeostasis,growth, reproduction ,…

Q: What are some recommendations to clinicians interested in incorporating body composition methods in…

A: Introduction :- Body composition means that the chemical compounds that makes up the human body , in…

Q: One of the biggest obstacles to the widespread use of ultrasound for body composition estimation in…

A: Impedance is defined as the resistance to current flow. The bioimpedance devices/techniques employ…