1. Given k sequences, design an algorithm to obtain a multiple alignment of k-1 sequences that excludes the least conserved sequence.
Q: What is the direct consequence of the hydrophobic effect that stabilizes the double helix
A: Approach to solving the question: Detailed explanation:In an aqueous environment, the hydrophobic…
Q: A spoonful of table salt dissolves in a bowl of soup. O chemical O physical S O neither
A:
Q: The concentration of the conjugate base in 100 mL of 50 mM CH3COOH/CH3COO- (pKa = 4.76) at pH 5.00…
A: Step 1: Calculation of the concentration of the conjugate base (CH3COO⁻) at pH 5.00.The…
Q: What volume (in L) of 1.30 M FeBr, would be required to obtain 0.800 moles of Br ions?
A: Step 1:
Q: Pleasseee explain I’m confused…….
A: The charges of a peptide at different pH values depend on the ionization states of its amino acid…
Q: Modify the structure of the compound provided to show the skeletal structure of the product that…
A: Step 1: Step 2: Step 3: Step 4:
Q: Consider a cell that requires much more ribose5-phosphate than NADPH. The cell needs ribose…
A: The question is asking about the metabolic fate of glucose 6-phosphate, glycolytic intermediates,…
Q: Please step by step answer and don't use ASI Answer
A: Step 1: Step 2: I have given detailed step by step instructions to solve the problem go through the…
Q: Using the information given on p. 4, consider the following comparison of titration curves of a…
A:
Q: Draw an organic compound that fits each of the following criteria. Part 1 of 2 A cyclic alkene (an…
A: 1.The above shown compound is a cyclic alkene with the molecular formula of C6H10. 2.The above…
Q: © Macmillan Learning Predict the amino acid sequences of peptides formed by ribosomes in response to…
A: In an mRNA sequence, a group of three bases (codon) is code for a specific amino acid. In the…
Q: Please help me fill in all the information
A: 1. **Conversion of Pyruvate to Acetyl-CoA**: - **Pyruvate Dehydrogenase Complex**: This complex of…
Q: help please answer in text form with proper workings and explanation for each and every part and…
A: Step 1: Given: Half-life of U is T21=4.5×109years Rate…
Q: Draw the structure of the product that forms when the carbonyl compound shown is treated with K₂ Cг2…
A: Detailed explanation: Starting MaterialYou have the compound:CH3 CH2 CH2 CO CH (CH3)2 which is…
Q: For a unimoleclar irreversible reaction, A -----> B, once the reactant A has entirely been…
A: For a unimolecular irreversible reaction A→B, Once the reactant A has entirely been converted to…
Q: Assume that the formation of nitrogen dioxide 2NO(g) + O2(g) 2 NO2 (g) is an elementary reaction. A…
A: Given the reaction:2NO(g)+O2(g)→2NO2(g)The half-life of the reaction is inversely proportional to…
Q: Under anerobic conditions how many ATP molecules will be produced when 3.5 moles of Glucose are…
A: Glycolysis:In anaerobic conditions, glycolysis is the primary pathway for glucose breakdown.During…
Q: None
A: Let's analyze each statement to determine which one is true.A tertiary (3º) amine has one H-bond…
Q: The chemical compound cyanogen burns with a flame that has a temperature of about 8,177 degrees…
A:
Q: You have discovered an organism incapable of performing the full gluconeogenic pathway. Further…
A: Missing Enzyme in the Gluconeogenic PathwayIdentification of the Missing EnzymeThe organism in…
Q: A fluorescence recovery after photobleaching (FRAP) was performed at 37 °C. If the experiment were…
A: The objective of the question is to understand the effect of temperature on the rate of fluorescence…
Q: can i get help?
A:
Q: None
A: Sir, if you have got the answer, please give me a helpful rate. Thank you
Q: Rank the following three compounds in order of decreasing basicity. NH2 NH₂ NH2 NO2 I II III A) II >…
A:
Q: (Biochemistry Topics: Glycolysis and Citric Acid Cycle) Why would a defect in the liver enzyme…
A: In mammals, fructose-1,6-bisphosphatase (Fbp) has two isotypes: liver and muscle, which are encoded…
Q: What is the reducing agent in the following equation? 2 Al (s) + 3 Sn2+ (aq) <-- 2 Al3+ (aq) + 3…
A: Given Equation:2 Al (s) + 3 Sn2+ (aq) ---> 2 Al3+ (aq) + 3 Sn (s) Step 1: Identify Oxidation…
Q: 4. i)List two reasons why membrane fusion is energy demanding. ii) List the three SNARE proteins…
A: Membrane Fusion and SNARE Proteinsi) Reasons Why Membrane Fusion is Energy DemandingElectrostatic…
Q: if each NADH generates 3 ATP molecules and each FADH2 generates 2 ATP molecules, calculate the…
A: The objective of this question is to calculate the total number of ATP molecules generated from one…
Q: Zinc-air batteries are actively being researched because one reactant (oxygen) is provided in…
A:
Q: Help 2
A: Explanation:The algorithm works by first identifying sequences related to the query sequence QQQ…
Q: 33 and 34
A: Step 1: Step 2: Step 3: Step 4:
Q: A 160 residue polytopic integral plasma membrane protein has the following sequence at its…
A: Step 1:To predict the overall tertiary structure of the 160-residue polytopic integral plasma…
Q: The most important contribution to the stability of a protein's conformation appears to be the: ○ A)…
A: The most important contribution to the stability of a protein's conformation appears to be the:…
Q: Draw the skeletal structure of a triacylglycerol that contains three molecules of caprylic acid.…
A: Step 1: Triacylglycerols (Triglycerides) Esters of glycerol and three fatty acids. They are the main…
Q: What is the major organic product obtained from the following reaction? 1 2 4 3 OH OH 2 Δ OH OH fron…
A:
Q: Aspirin (acetylsalicylic acid, structure below), has a pKa of 3.5. The pH at which aspirin is most…
A: Therefore, aspirin is most soluble in water when the pH is significantly higher than its pKa (pH…
Q: Draw a graph showing the relative amounts of the different ionized versions of arginine at different…
A: Step 1:
Q: None
A: Step 1: information on the name, mechanism, and conditions for this reaction.Name: This reaction is…
Q: Help please. How would I make the following buffers from Solid material? 1C
A: To prepare a 35 mM Tris buffer at pH 7.8 from solid material, follow these detailed steps: Materials…
Q: A specific single nucleotide variation in the human genome occurs with -2.5% frequency in the…
A: A missense mutation is a type of mutation that occurs within the protein-coding region of a gene,…
Q: Hemp oil contains eicosenoic acid (20:149) as its primary monounsaturated fatty acid. Let's consider…
A: Approach to solving the question: Detailed explanation:1.β-Oxidation Products and ATP Required for…
Q: Macmillan Learning of pyruvate to acetyl-CoA and of a-ketoglutarate to succinyl-CoA, although…
A: To complete the statements describing how the first stage of fatty acid β oxidation resembles…
Q: Show the arrow pushing mechanism for this cortisol reacton, thanks! ( Please step by step answer and…
A:
Q: Which of the following are the reduced (high energy) forms of the electron carriers nicotinamide…
A: NADH2; FADH2: In biochemistry, NADH and FADH2 are the reduced forms of NAD+ and FAD, respectively.…
Q: Match each autoimmune disease with its characteristics and the immune cell/s or molecules most…
A: Refer to the solution
Q: Your lunch meal contains rice, fish, vegetables and water for drinks. Identify the nutrients…
A:
Q: Which of the following compounds is the most reactive dienophile? H₂C=CH2 CH3 COOCH3 2 3 CH3 CH3
A: The most reactive dienophile in the image is compound 1, which is propenal. Dienophiles are…
Q: Predict the major product after all reactions occur.( Please step by step answer and don't use hand…
A: all reaction with proper format given below
Q: Consider the oxidation reactions of aldoses and ketoses for the following questions. Part 1 of 4 The…
A: Step 1: Step 2: Step 3: Step 4: Step 5: Step 6:
Q: Is phosphoglucomutase likely to be regulated? Why or why not? What about glucose 6-phosphate…
A: Phosphoglucomutase (PGM)Role in Metabolic PathwaysPhosphoglucomutase catalyzes the interconversion…
Help 1
Step by step
Solved in 2 steps
- 2c) If the whole potoroo genome is 4.2 x 10' bp, and the highlyrepetitive DNA in the potoroo genome is composed entirely ofcopies of the sequence 5'AAGACT' and its complement, howmany copies of this sequence are present in the potoroogenome?4. The bars in the following sequence indicate the breakpoints of a deletion. 5'-CGGGTATCTACTAAA|TTCGCACTTACGAGGATTAACATCCGATTG|TACCGAATGAGAATC-3' Which primer pair would you use to genotype for this deletion, such that all genotypes will result in a band? a. 5'-CGGGTATCTACTAAA-3' and 5'-TACCGAATGAGAATC-3' b. 5'-CGGGTATCTACTAAA-3' and 5'-GATTCTCATTCGGTA-3' с. 5'-CGGGTAТСТАСТААА-З" and 5'-CCТCGTAAGTGCGAA-3' d. 5'-CGGGTATCTACTAAA-3' and 5'-CATCCGATTGTACCG-3' e. There is no way to design a pair of primers that provide positive evidenceCompute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... | | | | | ATAGGAGCGAGAGT
- solve given problemIn the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is shown below. There is a stack at eachposition, even if short, because the sequence logo includes moredata. (a) Which three positions in this sequence logo have the mostpredictable bases? Name the most frequent base at each. (b) Whichfour positions have the least predictable bases? How can you tell?In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
- Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.: ACGTATCGCGTATA GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences. asap1. There are two different variations at STR locus THO1. Where did these variations come from? b) The STR locus D21S11 only has one variation. Why?When comparing (i.e., aligning) two or more genetic sequences, itis sometimes necessary to put in gaps. Explain why. Discuss twochanges (i.e., two types of mutations) that could happen during theevolution of homologous genes that would explain the occurrenceof gaps in a multiple-sequence alignment.
- Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtgaHow are the gap penalties adjusted in the ClustalW multiple sequence alignment program to improve the algorithm? Indicate the logic only.1、You have a 250 bp DNA sequence from a human protein-coding gene. What's the best tool to find out which gene matches this sequence? BLAST A Clustal algorithm (such as Clustal Omega) A Burrows-Wheeler algorithm (such as BWA) Just Google it 2、Sequence alignment algorithms like Burrows-Wheeler were primarily designed to handle many (millions) of short sequences and match them to a reference genome efficiently. Another property of these algorithms makes them suitable for use with RNAseq data. What property is this? Burrows-Wheeler can distinguish which strand of reference genome matches a sequencing read. Burrows-Wheeler can align a sequencing read that matches two different exons. Burrows-Wheeler uses a pre-compiled and compressed index of the reference genome. Burrows-Wheeler can be parallelized.
