1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20 b

Q: There may be more than one correct answer for each Repetitive DNA include which of the following?…

A: Introduction :- Microsatellites are short, repetitive sequences of DNA, typically consisting of 1-6…

Q: Bacterial DNA has how many origins of replication? A) 0 B) 1 C) 10 D) depends on the size of…

A: Two identical copies of a DNA molecule are produced by DNA replication. This is important for cell…

Q: Which molecule in the gel is the smallest - A, B, C, or D? Explain how you determined this. B)…

A:

Q: DNA replication always proceeds in only one direction because the ________ of the incoming…

A: DNA replication is an important part of the cell cycle and it takes place in the S-phase of the cell…

Q: Which of the following features of DNA is required for it to behave as a self-replicating molecule?…

A: DNA stands for deoxyribonucleic acid. It is a molecule that contains the genetic instructions used…

Q: The pro Tien responsible for the initial step in unwinding the DNA helix during replication of the…

A: Answer is dnaA. The protein responsible for the initial step in unwinding the dna helix during…

Q: Which of the following is true regarding the 5’ vs. the 3’ end of a strand of DNA? a) only…

A: 5' 3' linkage provides the sugar-phosphate backbone that gives DNA its structural rigidity. It is a…

Q: The enzyme that proofreads the new strand of DNA, looking for and correcting mistakes as it…

A: DNA replication is the process in which the two identical replicas of DNA from one original DNA…

Q: Which of the following is false when considering repetitive DNA?   a) STRs are the same as…

A: Noncoding regions include introns that do not code for any amino acids or proteins. However, they…

Q: Which of the following equations are true for double-stranded DNA?  a) (%G+%T) =(%A+%C) b) (%G+%A)…

A: DNA stands for deoxyribonucleic acid. It is a genetic material that passes from one generation to…

Q: You have a sample of genetic material. The nitrogenous base content is 29% guanine. a) If the…

A:

Q: The    figure    below    shows    a    polynucleotide: a)    Label    the    5'    and    the    3'…

A: Polynucleotide are polymer of nucleotides which are formed by the condensation of nucleotide.  The…

Q: DNA size (in bp) at which Tss is equal to Tm is a) 10000 bp b) 100 bp c) 500 bp d) 1000 bp e)…

A: DNA has two separate melting and strand separation temperatures, designated as Tm and Tss,…

Q: A DNA molecule consists of 500 nitrogenous bases, of which 150 are G bases. So, the percentage of…

A: The four kinds of nucleotides existing in double helix DNA are adenine (A), thymine (T), guanine (G)…

Q: Which of the following is NOT correct concerning the initiation of replication in E. coli?…

A: In E.coli, the DNA replication takes place by the binding of DnaA to the OriC (the origin of…

Q: In the diagram of replication shown here, fill in the blanks with the appropriate terms: (a) base…

A: Transmission of chromosomal DNA from generation to generation is crucial to cell propagation. This…

Q: What would happen to the base pairing of DNA if we removed the van der Waals dispersion forces?…

A: One may visualize the DNA structure as a spiraling ladder. The structure seen in the above image is…

Q: What type of weak interactions stabilize DNA a) salt bridges between bases on opposite strands b)…

A: DNA are polymers of nucleotides. A nucleotide consists of a nitrogenous base(A, T, G, C) attached to…

Q: The transposase enzyme is essential for transposition because

A: Answer:  Transposase is an enzyme which required for the transposition of elements of DNA.

Q: Match the definition on the left with the term on the right Tightly hypercolled DNA that is not in…

A: The DNA is the genetic material in human that is present within the nucleus of a cell. This DNA…

Q: Calculate the linking number “L” for a 210 base pair closed circular plasmid with 4 negative…

A:

Q: The Okazaki fragment is formed     a)  near the replication fork.   b)  on the lagging strand.…

A: According to the definition, DNA fragments created during DNA replication is called Okazaki…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…

Q: DNA double helix is stabilized by ...   a)  H-bonds between the sugar-phosphate backbones.   b)…

A: Answer. Watson and Crick first describe the structure of DNA double helix in 1953 e using x-ray…

Q: a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA,…

A: The capacity to extract DNA is critical for researching the genetic causes of disease and developing…

Q: 0. The two strands of DNA that make up the double helix are held to each other by …     a)…

A: The correct option is A hydrogen bonds between guanine / cytosine, and thymine / adenine

Q: 10) In the diagram below: a) Label a phosphodiester linkage b) Label an N-glycosidic bond c) Label…

A: Phosphodiester bond : This bond is formed by the condensation of sugar and phosphoric acid…

Q: Which of the following statements regarding polynucleotides is true? a) A double stranded DNA forms…

A: The correct answer is: a) A double-stranded DNA forms a right-handed helix, where both strands run…

Q: For linear 34,000 kb DNA calculate a) contour length; b) the length of DNA as packaged in…

A: Introduction "DNA Is A Molecule That Carries And Transmits Hereditary Information Or Genetic…

Q: r it 6- Complete the following: a) Two fragments of DNA can be joined by a b) Restriction enzymes…

A: Recombinant DNA technology is the process by which we can isolate our gene of interest and then…

Q: Which of the following items do not affect the melting temperature of DNA? A length of the DNA B the…

A: Melting temperature ( Tm): half of DNA gets denatured (melts). Tm = 2* (A+T) + 4* (G+C)

Q: From which end of a strand of nucleic acid does DNA polymerase I REMOVE nucleotides? A) 5' B) 3'…

A: DNA polymerase 1 has three types of polymerase activity. 1. 5'-3' polymerase activity- It is…

Q: For double-stranded DNA, which of the following statements is true? a) A = C b) A = G and C = T c) A…

A: For double stranded DNA,  According to Chargaff's rules state that DNA from any species of any…

Q: How many unique primers are required to amplify a single DNA target region?   a) 1 b) 2 c) 4 d)…

A: Targeted sequencing is a fast and low-cost method to detect known and novel variants in specific…

Q: Which of the following single stranded DNA oligonucleotides alone would be expected to spontaneously…

A: DNA is a double stranded structure in which each strands are made up of nucleotides. Nucleotide is…

Q: 1 5' AGT C CGAUGC3' 10 8. There are inaccuracies in the DNA molecule shown here. a) Name three…

A: Introduction : DNA is known as deoxyribonucleic acid and the nitrogen bases present in it are…

Q: Which of the following statements is false about DNA replication? A) Each lagging strand of DNA is…

A: DNA replication is the synthesis of new copies of DNA and occurs before cell division. It occurs in…

Q: Nucleosome structure: Identify the proteins indicated by the arrow. Hint: there are two of these…

A: option -a)histone H2A-H2B diner is correct.

Q: Which of the following is NOT a characteristic of the DNA Double Helix? a) The two strands run in an…

A: DNA, or deoxyribonucleic acid is a molecule that carries the genetic information necessary for the…

Q: During DNA replication the bond between the growing strand and the incoming nucleotide is formed…

A: Introduction: DNA replication follows a semiconservative pattern. Each of the double helix's strands…

Q: Which of the following enzymes has the highest functional error?  a) DNA Polymerase I b) DNA…

A: The proofreading activity of enzymes helps in reducing the number of errors. Proofreading activity…

Q: A temperature sensitive mutant is isolated where at the non-permissive temperature replication stops…

A: The process by which a cell copies its genetic material is called DNA replication. The unwinding of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.