Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 45.3, Problem 1EQ
What is the normal function of the PPAR-δ protein in mice?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The lac genotypes are as shown below:
P+OcZ-Y+A+// P¯O+Z+Y+A+
(i)
The lac operon consists of three structural genes, lacZ, lacY and lacA. Which
structural genes are involved in lactose metabolism? Explain.
(ii)
Draw and explain how lactose repress the gene expression in lac IS/I- heterozygote.
(iii)
What is the function of the promoter in the bacterial operon?
Discuss in general terms the principle of the regulation of theexpression of the trp gene with attenuation in bacteria.
What is the major function of a Src homology-2 (SH2) domain?
Chapter 45 Solutions
Biology
Ch. 45.1 - Prob. 1CCCh. 45.2 - Prob. 1CCCh. 45.2 - Prob. 1CSCh. 45.2 - Prob. 2CSCh. 45.3 - What is the normal function of the PPAR- protein...Ch. 45.3 - CoreSKILL What was the hypothesis proposed by...Ch. 45.3 - CoreSKILL Assume that the mean weight of both...Ch. 45 - Prob. 1TYCh. 45 - Prob. 2TYCh. 45 - Prob. 3TY
Ch. 45 - Prob. 4TYCh. 45 - The function of ATP during muscle contraction is...Ch. 45 - The function of Ca2+ in skeletal muscle...Ch. 45 - Stimulation of a muscle fiber by a motor neuron...Ch. 45 - Muscle fibers that have a large number of...Ch. 45 - Which of the following statements about movement...Ch. 45 - Prob. 10TYCh. 45 - Compare the structural and functional features of...Ch. 45 - Describe as many types of animal locomotion as you...Ch. 45 - Prob. 3CQCh. 45 - List and briefly describe the steps in the...Ch. 45 - Discuss the three types of muscle tissues found in...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes
Identify me theme or themes exemplified by (a) the sharp quills of a porcupine (b) the development of a multice...
Campbell Biology in Focus (2nd Edition)
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
HUMAN ANATOMY
An obese 55-year-old woman consults her physician about minor chest pains during exercise. Explain the physicia...
Biology: Life on Earth with Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is claudin16 genearrow_forwardIdentify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general function of the proteinarrow_forwardA particular type of anemia in humans, called b-thalassemia,results from a severe reduction or absence of the normal b-globinchain of hemoglobin. However, the g@globin chain, normally onlyexpressed during fetal development, can functionally substitutefor b-globin. A variety of studies have explored the use of thenucleoside 5-azacytidine for the expression of g-globin in adultpatients with b-thalassemia.(a) How might 5-azacytidine lead to expression of g-globin inadult patients?(b) Explain why this drug may also have some adverse side effects.arrow_forward
- What is the Results of tra splicing in the absence of Sxl protein?arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardConsider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…arrow_forward
- ATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of the following scenarios would most quickly regulate ATM activity in the cell? a) Adding silencing methyl groups to cytosines in the Atm gene b) Modifying the histone code for the Atm gene c) Increasing expression of a miRNA specific for the Atm mRNA d) Activating an E3 ubiquitin ligase specific for the ATM proteinarrow_forwardA pharmaceutical company developed a drug, CP788, that inhibits the interaction of Grb2 with SH2 domains as a treatment for breast cancer. As the data below shows, the compound inhibits activation of RAS in MDA-MB-468 breast cancer cells (Figure A) and anchorage-dependent growth (Figure B solid line) in MDA-MB-468 breast cancer cells. Note that these experimets were done in the presence of EGF. Briefly explain the steps in the pathway by which inhibition of Grb2/SH2 interaction would inhibit activation of RAS (limit 5-6 sentences). A Inhibition of RAS Activation by CP788 % RAS Activation 120 100 80 60 20 0 0 50 [CP788] UM 100 B Colonies number (% of untreated control) 120 100 80 60 40 20 0 10-² HigHt 10-¹ 10⁰ 10¹ 10² 10³ [CP788] UMarrow_forwardHow is the alternative splicing of Robo3 temporally regulated during midline crossing?arrow_forward
- The haemoglobin proteins of RNA polymerase ii sub units RPB1-P24928 RPB2-P30876 RPB3-P19387 RPB4-015514 are they similar? Explain?arrow_forwardFor each of the E. coli strains that follow, indicate theeffect of the genotype on the expression of the trpEand trpC genes in the presence or absence of tryptophan. [In the wild type (R+ P+ o+ att+ trpE+ trpC+),trpC and trpE are fully repressed in the presence oftryptophan and are fully expressed in the absence oftryptophan.]R = repressor gene; Rnproduct cannot bind tryptophan; R− product cannot bind operatoro = operator for the trp operon; o− cannot bind repressoratt = attenuator; att− is a deletion of the attenuatorP = promoter; P− is a deletion of the trp operonpromotertrpE− and trpC− are null (loss-of-function) mutationsa. R+ P− o+ att+ trpE+ trpC+b. R− P+ o+ att+ trpE+ trpC+c. RnP+ o+ att+ trpE+ trpC+d. R− P+ o+ att− trpE+ trpC+e. R+ P+ o− att+ trpE+ trpC−/R− P+ o+ att+trpE− trpC+f. R+ P− o+ att+ trpE+ trpC−/R− P+ o+ att+trpE− trpC+g. R+ P+ o− att− trpE+ trpC−/R− P+ o− att+trpE− trpC+arrow_forwardA mutation in the Ras protein renders Ras constitutively active (RasD). What is constitutive activation?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY