Which of the following are most closely associated with oxygen transport? (a) red blood cells (b) platelets (c) neutrophils (d) basophils (e) lymphocytes

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 44, Problem 1TYU

Which of the following are most closely associated with oxygen transport? (a) red blood cells (b) platelets (c) neutrophils (d) basophils (e) lymphocytes

Expert Solution & Answer

Summary Introduction

Introduction: There are various components in the body such as oxygen, nutrients, and various gases that need to be transported from one tissue to other. This is accomplished with the help of the body’s circulation system.

Answer to Problem 1TYU

Correct answer: Oxygen is transported in the body by the help of hemoglobin, and hemoglobin is present in the red blood cells. Hence, the correct answer is option (a).

Explanation of Solution

Reason for the correct answer:

Hemoglobin is present in the red blood cells. The main function of hemoglobin is to transport oxygen across the body. Therefore, red blood cells are responsible for the transportation of oxygen in the body.

Option (a) is given as “red blood cells”.

Oxygen is transported in the body by hemoglobin and hemoglobin is present in red blood cells. Hence, the correct answer is option (a).

Reasons for the incorrect answer:

Option (b) is given as “platelets”.

The main function of platelet is blood clotting and it does not contain hemoglobin. Hence, option (b) is incorrect.

Option (c) is given as “neutrophils”.

Neutrophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (c) is incorrect.

Option (d) is given as “basophils”.

Basophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (d) is incorrect.

Option (e) is given as “lymphocytes”.

Lymphocytes are a part of white blood cells and help in the protection of the body against antigens. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (e) is incorrect.

Hence, options (b), (c), (d), and (e) are incorrect.

Conclusion

Red blood cells transport oxygen with the help of hemoglobin.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Textbook Question

Chapter 44, Problem 1TYU

Which of the following are most closely associated with oxygen transport? (a) red blood cells (b) platelets (c) neutrophils (d) basophils (e) lymphocytes

Expert Solution & Answer

Summary Introduction

Introduction: There are various components in the body such as oxygen, nutrients, and various gases that need to be transported from one tissue to other. This is accomplished with the help of the body’s circulation system.

Answer to Problem 1TYU

Correct answer: Oxygen is transported in the body by the help of hemoglobin, and hemoglobin is present in the red blood cells. Hence, the correct answer is option (a).

Explanation of Solution

Reason for the correct answer:

Hemoglobin is present in the red blood cells. The main function of hemoglobin is to transport oxygen across the body. Therefore, red blood cells are responsible for the transportation of oxygen in the body.

Option (a) is given as “red blood cells”.

Oxygen is transported in the body by hemoglobin and hemoglobin is present in red blood cells. Hence, the correct answer is option (a).

Reasons for the incorrect answer:

Option (b) is given as “platelets”.

The main function of platelet is blood clotting and it does not contain hemoglobin. Hence, option (b) is incorrect.

Option (c) is given as “neutrophils”.

Neutrophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (c) is incorrect.

Option (d) is given as “basophils”.

Basophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (d) is incorrect.

Option (e) is given as “lymphocytes”.

Lymphocytes are a part of white blood cells and help in the protection of the body against antigens. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (e) is incorrect.

Hence, options (b), (c), (d), and (e) are incorrect.

Conclusion

Red blood cells transport oxygen with the help of hemoglobin.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 44, Problem 1TYU

Which of the following are most closely associated with oxygen transport? (a) red blood cells (b) platelets (c) neutrophils (d) basophils (e) lymphocytes

Expert Solution & Answer

Summary Introduction

Introduction: There are various components in the body such as oxygen, nutrients, and various gases that need to be transported from one tissue to other. This is accomplished with the help of the body’s circulation system.

Answer to Problem 1TYU

Correct answer: Oxygen is transported in the body by the help of hemoglobin, and hemoglobin is present in the red blood cells. Hence, the correct answer is option (a).

Explanation of Solution

Reason for the correct answer:

Hemoglobin is present in the red blood cells. The main function of hemoglobin is to transport oxygen across the body. Therefore, red blood cells are responsible for the transportation of oxygen in the body.

Option (a) is given as “red blood cells”.

Oxygen is transported in the body by hemoglobin and hemoglobin is present in red blood cells. Hence, the correct answer is option (a).

Reasons for the incorrect answer:

Option (b) is given as “platelets”.

The main function of platelet is blood clotting and it does not contain hemoglobin. Hence, option (b) is incorrect.

Option (c) is given as “neutrophils”.

Neutrophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (c) is incorrect.

Option (d) is given as “basophils”.

Basophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (d) is incorrect.

Option (e) is given as “lymphocytes”.

Lymphocytes are a part of white blood cells and help in the protection of the body against antigens. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (e) is incorrect.

Hence, options (b), (c), (d), and (e) are incorrect.

Conclusion

Red blood cells transport oxygen with the help of hemoglobin.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 44, Problem 1TYU

Which of the following are most closely associated with oxygen transport? (a) red blood cells (b) platelets (c) neutrophils (d) basophils (e) lymphocytes

Expert Solution & Answer

Summary Introduction

Introduction: There are various components in the body such as oxygen, nutrients, and various gases that need to be transported from one tissue to other. This is accomplished with the help of the body’s circulation system.

Answer to Problem 1TYU

Correct answer: Oxygen is transported in the body by the help of hemoglobin, and hemoglobin is present in the red blood cells. Hence, the correct answer is option (a).

Explanation of Solution

Reason for the correct answer:

Hemoglobin is present in the red blood cells. The main function of hemoglobin is to transport oxygen across the body. Therefore, red blood cells are responsible for the transportation of oxygen in the body.

Option (a) is given as “red blood cells”.

Oxygen is transported in the body by hemoglobin and hemoglobin is present in red blood cells. Hence, the correct answer is option (a).

Reasons for the incorrect answer:

Option (b) is given as “platelets”.

The main function of platelet is blood clotting and it does not contain hemoglobin. Hence, option (b) is incorrect.

Option (c) is given as “neutrophils”.

Neutrophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (c) is incorrect.

Option (d) is given as “basophils”.

Basophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (d) is incorrect.

Option (e) is given as “lymphocytes”.

Lymphocytes are a part of white blood cells and help in the protection of the body against antigens. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (e) is incorrect.

Hence, options (b), (c), (d), and (e) are incorrect.

Conclusion

Red blood cells transport oxygen with the help of hemoglobin.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

Introduction: There are various components in the body such as oxygen, nutrients, and various gases that need to be transported from one tissue to other. This is accomplished with the help of the body’s circulation system.

Answer to Problem 1TYU

Correct answer: Oxygen is transported in the body by the help of hemoglobin, and hemoglobin is present in the red blood cells. Hence, the correct answer is option (a).

Explanation of Solution

Reason for the correct answer:

Hemoglobin is present in the red blood cells. The main function of hemoglobin is to transport oxygen across the body. Therefore, red blood cells are responsible for the transportation of oxygen in the body.

Option (a) is given as “red blood cells”.

Oxygen is transported in the body by hemoglobin and hemoglobin is present in red blood cells. Hence, the correct answer is option (a).

Reasons for the incorrect answer:

Option (b) is given as “platelets”.

The main function of platelet is blood clotting and it does not contain hemoglobin. Hence, option (b) is incorrect.

Option (c) is given as “neutrophils”.

Neutrophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (c) is incorrect.

Option (d) is given as “basophils”.

Basophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (d) is incorrect.

Option (e) is given as “lymphocytes”.

Lymphocytes are a part of white blood cells and help in the protection of the body against antigens. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (e) is incorrect.

Hence, options (b), (c), (d), and (e) are incorrect.

Conclusion

Red blood cells transport oxygen with the help of hemoglobin.

Answer 8

Expert Solution & Answer

Summary Introduction

Introduction: There are various components in the body such as oxygen, nutrients, and various gases that need to be transported from one tissue to other. This is accomplished with the help of the body’s circulation system.

Answer to Problem 1TYU

Correct answer: Oxygen is transported in the body by the help of hemoglobin, and hemoglobin is present in the red blood cells. Hence, the correct answer is option (a).

Explanation of Solution

Reason for the correct answer:

Hemoglobin is present in the red blood cells. The main function of hemoglobin is to transport oxygen across the body. Therefore, red blood cells are responsible for the transportation of oxygen in the body.

Option (a) is given as “red blood cells”.

Oxygen is transported in the body by hemoglobin and hemoglobin is present in red blood cells. Hence, the correct answer is option (a).

Reasons for the incorrect answer:

Option (b) is given as “platelets”.

The main function of platelet is blood clotting and it does not contain hemoglobin. Hence, option (b) is incorrect.

Option (c) is given as “neutrophils”.

Neutrophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (c) is incorrect.

Option (d) is given as “basophils”.

Basophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (d) is incorrect.

Option (e) is given as “lymphocytes”.

Lymphocytes are a part of white blood cells and help in the protection of the body against antigens. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (e) is incorrect.

Hence, options (b), (c), (d), and (e) are incorrect.

Conclusion

Red blood cells transport oxygen with the help of hemoglobin.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

Introduction: There are various components in the body such as oxygen, nutrients, and various gases that need to be transported from one tissue to other. This is accomplished with the help of the body’s circulation system.

Answer 12

Answer to Problem 1TYU

Correct answer: Oxygen is transported in the body by the help of hemoglobin, and hemoglobin is present in the red blood cells. Hence, the correct answer is option (a).

Answer 13

Explanation of Solution

Reason for the correct answer:

Hemoglobin is present in the red blood cells. The main function of hemoglobin is to transport oxygen across the body. Therefore, red blood cells are responsible for the transportation of oxygen in the body.

Option (a) is given as “red blood cells”.

Oxygen is transported in the body by hemoglobin and hemoglobin is present in red blood cells. Hence, the correct answer is option (a).

Reasons for the incorrect answer:

Option (b) is given as “platelets”.

The main function of platelet is blood clotting and it does not contain hemoglobin. Hence, option (b) is incorrect.

Option (c) is given as “neutrophils”.

Neutrophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (c) is incorrect.

Option (d) is given as “basophils”.

Basophils are part of white blood cells. The function of WBC’s is to provide protection to the body. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (d) is incorrect.

Option (e) is given as “lymphocytes”.

Lymphocytes are a part of white blood cells and help in the protection of the body against antigens. They lack hemoglobin and thus do not help in oxygen transport. Hence, option (e) is incorrect.

Hence, options (b), (c), (d), and (e) are incorrect.

Answer 14

Conclusion

Red blood cells transport oxygen with the help of hemoglobin.

Answer 15

Ch. 44.1 - Types of Circulatory Systems Contrast internal...Ch. 44.1 - Compare how oxygen is transported to the body...Ch. 44.1 - Prob. 2C Ch. 44.1 - What are five functions of the vertebrate...Ch. 44.2 - Prob. 2LO Ch. 44.2 - Summarize the sequence of events involved in blood...Ch. 44.2 - Prob. 1C Ch. 44.2 - Prob. 2C Ch. 44.2 - Prob. 3C Ch. 44.3 - Prob. 4LO

Which of the following are most closely associated with oxygen transport? (a) red blood cells (b) platelets (c) neutrophils (d) basophils (e) lymphocytes

Videos

Answer to Problem 1TYU

Explanation of Solution

Want to see more full solutions like this?

Chapter 44 Solutions