
Compare the nodes and branches that lead to the monophyletic taxa Basidiomycota and Ascomycota. How do they differ from those leading to Zygomycota and Chytridiomycota? What can be concluded from this?

Fungi composed of an enormous group of organisms, nearly 90,000 species of fungi have been identified. The molecular technique applications combined with morphological as well as ecological considerations have led to an understanding of fungal phylogenetic relationships. Chytridiomycota, Ascomycota, Glomeromycota, Basidiomycota, Zygomycota, and Basidiomycota are considered as the six major fungal groups.
Explanation of Solution
Basidiomycota is filamentous fungi made of the hypha. In general, they reproduce sexually by the formation of specialized club-shaped cells, called basidia. Whereas Ascomycota, sac fungi, are filamentous fungi that reproduce sexually by means of the ascus,
Chytridiomycota and Zygomycota are situated at multiple nodes, whereas Ascomycetes and Basidiomycetes are located only at one node. From this, it can be concluded that the former (Chytridiomycota and Zygomycota) are paraphyletic (multiple origins), whereas the latter (Ascomycetes and Basidiomycetes) are monophyletic (one common ancestor).
Want to see more full solutions like this?
Chapter 26 Solutions
Prescott's Microbiology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax




