
Concept explainers
Give the meanings of the following terms: genomics, functional genomics, and proteomics.

To review:
The definition of functional genomics, genomics, and proteomics.
Introduction:
The genetic material of a species consists of thousands of genes. In order to understand the phenotypic differences of two individuals, it is very important to study the genome of two organisms separately as well as together.
Explanation of Solution
The description of functional genomics, genomics, and proteomics is given below:
Genomics: It refers to the analysis of the complete genome of an individual. It integrates DNA (Deoxyribonucleic acid) sequencing methods, bioinformatics, and recombinant DNA to obtain the complete sequence of all the chromosomes.
Functional genomics: The analysis of all the genes and intervening sequences which have been obtained by sequencing methods comes under functional genomics. The goal is to obtain the functions of all these elements and analyze the ways, in which they interact with each other to result in specific phenotype. Understanding the function of centromeres as well as repetitive sequences are also included in it.
Proteomics: Proteins are a product of genes in an individual. Proteins are greater than the number of genes. Proteomics is an extensive study of the whole complement of proteins in an individual, their physiological functions, and structures.
Therefore, it can be concluded that genomics aim at obtaining the complete genome of an individual, functional genomics focuses on the functions of the gene and its interaction with one another, and proteomics aims to understand the structure as well as functions of all the proteins in an individual.
Want to see more full solutions like this?
Chapter 24 Solutions
Genetics: Analysis and Principles
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage




