CAMPBELL BIOLOGY-W/MOD.MASTERBIOLOGY
11th Edition
ISBN: 9780134683461
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 7TYU
Expression of a cloned eukaryotic gene in a bacterial cell involves many challenges. The use of mRNA and reverse transcriptase is part of a strategy to solve the problm of
- (A) post -transcriptional processing.
- (B) post-translational processing.
- (C)
nucleic acid hybridization. - (D) restriction fragment ligation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Codon optimization is a widely used process for recombinant expression in prokaryotic systems. Regarding this process, mark the incorrect alternative. *
A)increases the overall yield of expression of recombinant proteins.
B)prevents the formation of truncated proteins. C)increases the frequency of tRNAs that recognize rare codons.
D)does not interfere with the primary sequence of the recombinant protein.
Which of the following is not true of cDNA produced using human brain tissue as the starting material? (A) It can be amplified by the polymerase chain reaction. (B) It was produced from pre-mRNA using reverse transcriptase. (C) It can be labeled and used as a probe to detect genes expressed in the brain. (D) It lacks the introns of the premRNA
please explain
Chapter 20 Solutions
CAMPBELL BIOLOGY-W/MOD.MASTERBIOLOGY
Ch. 20.1 - Prob. 1CCCh. 20.1 - DRAW IT One Strand of a DNA molecule has the...Ch. 20.1 - What are some potential difficulties in using...Ch. 20.1 - VISUAL SKILLS Compare Figure 20.7 with Figure...Ch. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - DNA technology has many medical applications....Ch. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 9TYUCh. 20 - MAKE CONNECTIONS Looking at Figure 20.15, what...Ch. 20 - DRAW IT You are cloning an aardvark gene, using a...Ch. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 13TYUCh. 20 - Prob. 14TYUCh. 20 - The water in the Yellowstone National Park hot...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes
1. Rub your hands together vigorously. What happens? Discuss the energy transfers and transformations that take...
College Physics: A Strategic Approach (3rd Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
SEELEY'S ANATOMY+PHYSIOLOGY
An obese 55-year-old woman consults her physician about minor chest pains during exercise. Explain the physicia...
Biology: Life on Earth with Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and Bcll. a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage by BamHI result in a 5' or 3' overhang? 5... GGATCC...3' 3...CCTAGG...5' b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by , Bcll result in a 5' or 3' overhang? 5... TGATCA...3' 3'... ACTAGT.. 5' You are given the DNA shown below. 5 ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. e) If you ligate or join the smaller restriction fragment in step c with the smaller restriction fragment in step d, what…arrow_forwardIn generating mutations in a bacterial gene involved in antibiotic resistance, a number of point mutations are isolated that render the bacteria sensitive to the antibiotic. You would like to sequence the gene in order to characterize the mutations, but unfortunately, your lab partner just finished the last of the lab's supply of DNA polymerase. The only things at your disposal are materials for performing a western blot, allowing you to visualize the protein encoded by the gene. How would you identify which mutations are likely to be the result of a missense mutation, which are likely to be the result of a nonsense mutation, and which are likely to be the result of a frameshift mutation?arrow_forward1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHl and Bcll. a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage by BamHl result in a 5' or 3' overhang? 5... G'GATCC...3 3...CCTAGG...5 b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by Bcll result in a 5' or 3' overhang? 5... TGATCA...3 3... ACTAGT...5 You are given the DNA shown below. 5' ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. e) If you ligate or join the smaller restriction fragment in step c with the smaller restriction fragment in step d, what would…arrow_forward
- Mutagenesis is a technique in which genetic information of an organism is altered in a stable manner resulting in a mutation. It may occur spontaneously in nature of as a result of exposure to mutagens. It can also be achieved experimentally using optimized laboratory procedures. (i) (ii) What is site directed mutagenesis (SDM)? Explain how SDM can assist in the integration of a His-tag at the end of your gene of interest.arrow_forwardCompare DNA polymerase and RNA polymerase from E. coli in regard to each of the following features: (a) activated precursors,(b) direction of chain elongation, (c) conservation of the template, and(d) need for a primer.arrow_forwardA full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein. a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria. b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?arrow_forward
- Which of the following statements concerning the sequence of events involved in the initiation of transcription by E. coli RNA polymerase are correct? ( can bemore than one) A.)Initiation starts with a pyrimidine nucleotide triphosphate. B.)The sigma factor (σ) functions during initiation of transcription. C.)Initiation starts with a purine nucleotide triphosphate, which is destined to become the 5'-end of RNA. D.)Initiation starts with a purine nucleotide triphosphate, which is destined to become the 3'-end of RNA. E.)RNA polymerase binds to the DNA at a point approximately 35 bp upstream of the start of transcription, at a sequence TTGACA. F.)The sigma factor does not dissociate until RNA elongation is complete.arrow_forwardMatch the following terms related to transcription in eukaryotes (you may use terms more than once or not at all) A) RNA Polymerase I, B) RNA Polymerase II, C) RNA Polymerase III, D) All 3 RNA Polymerases E) None of the above 1. Driven only by downstream promoter elements __________ 2. Promoter contains TATA box __________ 3. rRNA __________ 4. tRNA __________ 5. mRNA __________ 6. snRNA __________ 7. A second class of promoters contains CAAT box 100-200 nucleotides from the start site of transcription __________ 8. Synthesize RNA 5’ to 3’ __________ 9. Synthesizes RNA 3’ to 5’ __________ 10. Very sensitive to α-amanitin __________arrow_forwardCRISPR-Cas9 is used by bacteria as a type of immune system against invading viruses. In recent years, it has been developed into a revolutionary tool that can induce double-stranded breaks at very specific locations in DNA in eukaryotic cells. CRISPR-Cas9 activity typically results in indel mutations in the targeted gene. Which DNA repair system most likely caused these indels? a) non-homologous end-joining b) mismatch repairc) nucleotide-excision repaird) base-excision repair e) homology-directed repairarrow_forward
- Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?arrow_forwardDescribe the cloning strategies that are mediated by homopolymers tailing, linkers and adaptors. How can adaptors be employed for the creation of a novel restriction enzyme site for the introduction of the insert DNA?arrow_forwardA mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License