Answered: What is the value of a in the main…

What is the value of a in the main function after running the following code? Assume all header files and function are declared. int main() { int a = 40; float b =-6.1; func(b, a); cout<

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

C PROGRAM- USING DATA ABSTRACTION Create: the library(header file), source file(definition), main(test all the functions). Define the following: 1. A Celsius (centigrade) temperature can be converted to an equivalent Fahrenheit temperature according to the following formula f = (9/5)*C+32. Write a function that accepts temperature in degree Celsius and returns the equivalent Fahrenheit.
#include <iostream> #include <cmath> using namespace std; // declare functions void display_menu(); void convert_temp(); double to_celsius(double fahrenheit); double to_fahrenheit(double celsius); int main() { cout << "Convert Temperatures\n\n"; display_menu(); char again = 'y'; while (again == 'y') { convert_temp(); cout << "Convert another temperature? (y/n): "; cin >> again; cout << endl; } cout << "Bye!\n"; } // define functions void display_menu() { cout << "MENU\n" << "1. Fahrenheit to Celsius\n" << "2. Celsius to Fahrenheit\n\n"; } void convert_temp() { int option; cout << "Enter a menu option: "; cin >> option; double f = 0.0; double c = 0.0; switch (option) { case 1: cout << "Enter degrees Fahrenheit: "; cin >> f; c =…
#include <iostream> using namespace std; int rectArea (int len, int wid) { return len * wid; } int main () { int length, width; cin >> length >> width; cout << "The area of a " << length << " by " << width << " rectangle is " << /*add code to call the reacArea function */ << "." << endl; return 0; }
Write a program that prompts the user to enter two positive integers. Implement a function to validate the user input. The program will use a loop to re-prompt a user for an input until a user inserts a valid input. Implement a summation function.The program will sum those two integers and show a result on a terminal screen. The program must have a lease two functions. #1 Examples output: input1 - 7 input2 = 6 7+6 - 13 # 2 Examples output: input1 = 0 try again = -5 try again = 10 input2 - 6 10 + 6 - 16 Please fill in the source code below: #include using namespace std; int input); (int a, int b); int int input1= 0; int input2 = 0; cout<<"Input1 = "; input1 = (input1); cout<<"Input2 = "; input2 = getPositivelnput( átv S MacBook Air DII DD 80 888 F7 F8 F9 F4 F5 F6 F3 * & #3 2$ 7 CO
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Explain how inline functions differ from normal functions when called in the background.
Discussion: Files with .h extension are called header files in C. These header files generally contain function declarations which we can be used in main C program, like for e.g. to include stdio.h in C program to use function printf() Exercise 2. Creating myhead.h : Write the below code and then save the file as myhead.h or you can give any name but the extension should be .h indicating it’s a header file. // It is not recommended to put function definitions // in a header file. Ideally there should be only // function declarations. Purpose of this code is // to only demonstrate working of header files. void add(int a, int b) { printf("Added value=%d\n", a + b); } void multiply(int a, int b) { printf("Multiplied value=%d\n", a * b); } Including the .h file in other program : Now as we need to include stdio.h as #include in order to use printf() function. We will also need to include the above header file myhead.h as #include”myhead.h”. The ” ” here are used to instruct…
14. What is the value of a and b after the function call myfunction1(a,b) in the main function? void myfunction1(int a, int &b) { a+t; b++; int main() { int a=5,b=53; myfunction1(a,b): } a) a=5,b=5 b) a=5,b=6 c) a=6,b=5 d) a=6,b=6
Declare a vector of integers in C++ named vec and initialize the vector to 10, 20, 30, 40, and 50. Modify the first element of the vector to be 100 and modify the last element to be 1000. The resulting vector should then be 100, 20, 30, 40, and 1000. Using cout statements, display the resulting vector to the terminal.
#include <iostream> #include <cmath> using namespace std; // declare functions void display_menu(); void convert_temp(); double to_celsius(double fahrenheit); double to_fahrenheit(double celsius); int main() { cout << "Convert Temperatures\n\n"; display_menu(); char again = 'y'; while (again == 'y') { convert_temp(); cout << "Convert another temperature? (y/n): "; cin >> again; cout << endl; } cout << "Bye!\n"; } // define functions void display_menu() { cout << "MENU\n" << "1. Fahrenheit to Celsius\n" << "2. Celsius to Fahrenheit\n\n"; } void convert_temp() { int option; cout << "Enter a menu option: "; cin >> option; double f = 0.0; double c = 0.0; switch (option) { case 1: cout << "Enter degrees Fahrenheit: "; cin >> f; c =…
Consider the following function. int my_func(int a) { return(a+3); } If the function is called using my_func(5), what will the function return?
Programming Language: C++ I really need help with this question and I keep getting repost answers. Please, someone, help with a genuine understanding of the problem. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE];…