he phylogenetic tree of the OCTN homologs below was generated with the following accession numbers as the basis:  NP_957143.1 - OCTN of unknown function  CDM63451.1 - OCTN specific for ergothioneine transport  XP_021324939.1 - OCTN specific for carnitine transport Which of the Salmo salar homologs has the most probable function as an ergothioneine transporter? Why?

Q: Why are eukaryotic polyribosomes circular?  Check all that apply. Only mRNAs that are bound to…

A: Polyribosomes, clusters of ribosomes translating an mRNA molecule, are crucial for protein synthesis…

Q: (d) ( through the disulfide bridge. If this bridge were found for the two joined amino acids free in…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 1. Peroxisomes are organelles surrounded by a single membrane. Soluble proteins that reside within…

A: Answer a)  If we do mutation at the c terminus skl tripeptide signal sequence then this protein will…

Q: 10. The amino terminus of a wildtype enzyme in yeast has the amino acid sequence…

A: In this experiment, we investigated the effects of two mutations on the production of a tripeptide.…

Q: Write the detail or exact information of the following of molecule “X” with UniProtKB accession…

A: Hello, thank you for your question. As per our guidelines, I am answering only the first three…

Q: 2. Design a primer pair using NCBI Primer-BLAST for gene RNA 2',3'-cyclic phosphate and 5'- OH…

A: Forward primer:A primer that binds to antisense or plus strand of DNA is called as forward…

Q: Mutational analysis of the important amino acids in the catalytic triad of serine proteases showed…

A: The catalytic triad provides a paradigm for the structural and chemical features of enzymes that…

Q: A chain of biochemical events is responsible for Aequorea victoria turning green. Firstly, the…

A: Gel filtration chromatography, or size exclusion chromatography, is a chromatographic technique for…

Q: What experimentally derived information led to Holley’s proposal of the two-dimensional cloverleaf…

A: Introduction:  The structure of tRNA was first elucidated by Holley for the amino acid alanine. Its…

Q: What is the simplest explanation for why patients have been identified with only one copy of the…

A: Phosphofructokinase deficiency results in exercise intolerance. It causes the accumulation of…

Q: Describe how polymorphisms is found at 13910-C/T and 22018-G/A in the regulatory area of the lactase…

A: Lactose is the main sugar in milk, which is a disaccharide. It is hydrolyzed by intestinal lactase…

Q: In BLOSUM62 matrix, a conserved Tryptophan position has score S(W,W) = 11, but a conserved Leucine…

A: BLOSUM is a block substitution matrix that is used to analyze and identify the best possible…

Q: How many times does the enzyme Mbol cut between positions 1426-2789 inclusively of the sequence with…

A: The Mbol is a restriction enzyme. Restriction enzymes cleave the double-stranded DNA at the…

Q: pecies 1: ATT GCA GGC TTG AAA pecies 2: ATA GAA GGT TTG AAC Make the simplifying assumption that all…

A: The ratio of the number of nonsynonymous substitutions per nonsynonymous site (Ka) to the number of…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: High salt concentrations tend to cause protein aggregation. Suggest a way to identify proteins…

A: Introduction: Small, microscopic organisms are well-defined and usually described as known as…

Q: HS IP: FLAG-KDM3A SIA - WT + Lane Number: 1 2 3 S/D 4 5 6 Stat1 FLAG

A: KDM3A phosphorylation after 30 or 60 minutes of heat shock at 42°C (heat shock (HS) is generally…

Q: You have purified a recombinant form of the p53 protein from E. coli and determined the A280 to be…

A: Beers law states that the absorbance of a sample depends on the amount of sample present and path…

Q: What do these data say about the requirements for v-SNARES and t-SNARES in the fusion of vacuolar…

A: As mentioned SNARES are important for membrane fusion of vesicles. v SNARES and t SNARES are…

Q: What are the detail or exact information of the following of molecule “X” with UniProtKB accession…

A: UniProt stands for, universal protein resource .  its a digital platform that has vast, curated,…

Q: The SARS-CoV-2 genome has a cap at its 5'-end that is the same as the one seen on most human mRNA…

A:

Q: Bovine ribonuclease folds with ΔH° = -280 kJ mol-1 and ΔS° = -0.79 kJ mol-1 K -1. Assume ΔH° and ΔS°…

A: The basis for predicting spontaneity of a reaction is based on (ΔG), the change in G, at constant T…

Q: Why is the position of Cys 58  important in 3GRS(GLUTATHIONE REDUCTASE)? When Cys 58  is mutated to…

A: Dear Students, I have downloaded the PDB ID 3GRS structure from https://www.rcsb.org/ This is the…

Q: In each of the following cases, predict whether the pKa value of the first residue will be upshifted…

A: The pKa of a protein refers to the pH at which half of the protein's acidic residues (such as Asp or…

Q: 1 Sardinella tawilis voucher TaSt3 cytochrome oxidase subunit 1 (COI) gene, partial cds;…

A: In order to understand biological data more clearly Bioinformatics uses various software tools.…

Q: Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This techniqu had indeed…

A: PCR is used to amplify a specific DNA sample.

Q: Yeast cells are eukaryotes, and they require a functional secretory pathway to grow and to maintain…

A: Yeast are single-celled microorganisms. These are classified, along with molds and mushrooms, as…

Q: 2- The odorant-binding protein (OBP) was described in rat and cow as a lipocalin that binds odorants…

A: Abstract NGAL (neutrophil gelatinase-associated lipocalin) also known as lcn2 or siderochalin is…

Q: Given the following complementation chart for holes in Monstera, give me the biochemical (phenotype)…

A: When the normal phenotype is restored by the complementation effect of the two mutants, then it is…

Q: What is the possible consequence(s) of a Q188R mutation for the function of the protein? Keeping…

A: Q188R is one of the common mutations occurring in the gene coding for galactose l-phosphate…

Q: In biochemical and structural terms, how does the cellular form of the prion protein differ from the…

A: There are different macromolecules present in the living organism. Of which proteins are one of the…

Q: Draw the structure of Arg - Lys - Ser - Trp at ph 7.4

A: The proteins are biological macromolecules that are composed of twenty naturally occurring amino…

Q: Genetic testing of a 29-month-old boy shows a mutation in the Phe residue at position 508 in the…

A: Cystic fibrosis is a fatal genetic disease which is caused due to defect in CF transmembrane…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: Three consecutive nucleotides form a triplet termed a codon that codes for a single amino acid.…

Q: There was a study done (Isabel, et al.) on structural analysis of SARS-CoV-2 spike protein. The…

A: Hydrophobic groups are non-polar. These have a very low affinity with the polar groups. However,…

Q: Group 3) Replacing an A with a T in a hemoglobin gene is associated with sickle-cell anemia in…

A: Sickle cell disease (SCD) is a hereditary illness caused by a mutation in both copies of the HBB…

Q: he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in…

A: Given: The sequence of the alpha-2 globin of the human hemoglobin gene cluster found in chromosome…

Q: The genomes of most multicellular eukaryotes encode~25,000 genes, yet their proteomes contain over…

A: Genes are the stretch of the DNA that codes for the polypeptide chain during the process of gene…

Q: Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I…

A: To identify the open reading frame (ORF) in a given DNA sequence, we need to locate the start codon…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.