d. Name some compounds official in the compendia used as antacids. Give some commercial products containing them. (Gastrointestinal Agents) e. Write the equations involved in the neutralization process of antacids. (Gastrointestinal Agents) f. Name the components of products used in treating diarrhea and give the functions of each. (Gastrointestinal Agents)

Q: What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceTool…

A: NCBI is the database that stores the information regarding the gene sequences and protein sequences.…

Q: QUESTION Hershey & Chase ultimately found radioactive DNA in the meaning that the DNA was the cells…

A: Hershey and Chase are the scientists who proved that DNA is genetic material and carries genetic…

Q: This BLAST program performs the greatest number of searches for the same query sequence and database…

A: BLAST is used in bioinformatics an an algorithm which compares the sequences of amino acids and of…

Q: Question: Can two people have the same DNA?

A: *Humans will have 99.9% of DNA with each other. *So only 0.1% of  DNA is unique to all individuals.…

Q: DNA extraction, PCR, gel electrophoresis, and DNA sequencing of PCR products. Give a description of…

A: DNA extraction is the procedure of isolating the Deoxyribonucleic acid from biological samples. PCR…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: DNA Extraction using Tomato     DNA Extraction by Mouthwash

A: DNA extraction is a technique for isolating DNA from cell membranes, proteins, and other biological…

Q: 1. What are two good usages for synthetic biology you may pursue? Please give examples. 2. What are…

A: Synthetic biology is a branch of science that aims to build complete biological systems out of their…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: A gene is a segment of DNA that contains the necessary information for the synthesis of a functional…

Q: If one nucleotide is randomly changed in a DNA sequence, that is an example of ___ mutation

A: To answer this question we should have knowledge of biochemistry.

Q: * ? In BCI, in your opinion which part of the operation is the hardest one

A: BCI is Brain Computer interfaces. BCI is useful for the person who are suffering from neurological…

Q: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting…

A: The human genome is composed of sequences of nucleic acids, which are encoded as DNA(Deoxyribo…

Q: In eukaryotic cells, __________ copying initiates nearlysimultaneously at thousands of origins of…

A: The origin of replication refers to the specific sequence present in the genome that triggers the…

Q: Which of these is not considered a method of DNA extraction? organic filtration differential…

A: DNA (deoxyribonucleic acid) extraction is a procedure to isolate DNA from the cells.  It is a method…

Q: DNA is pretty important because it is instructs what proteins to make. the energy producer in a…

A: Introduction DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in…

Q: What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceToo Best…

A: The best option is (a) Basic Local Alignment Search Tool.

Q: I want you to prepare a report of 2-3 pages summarizing the genetic disease (Kearns -sayre syndrome…

A: Kearns-Sayre condition (KSS) is a rare neuromuscular disorder with beginning generally before the…

Q: The algorithm or tool in MEGA that is used for multiple sequence alignment of nucleotide/DNA…

A: Introduction In bioinformatics MSA (Multiple Sequence Alignment)  is generally the alignment method…

Q: dentify the following structures, please label your answers with the corresponding number and be…

A: Question  72) Reissner's membrane  73) Tectorial membrane  74) Outer hair cells

Q: The process to find limit resolution.

A: Given: The process to find limit resolution.

Q: Biochemistry techniques have been used for the analysis on biomolecules such as enzymes, DNA,…

A: Polymerase chain reaction, or PCR, is a biotechnological technique to make synthesize copies of a…

Q: True or False. Nonhomologous endjoining usually alters the DNA by deletions or insertions.

A: introduction :  Chromosomes that do not come from the same pair are referred to as non-homologous…

Q: True or false: During DNA isolation, ice cold 95% ethanol is used to digest the DNA into fragments…

A: During DNA isolation 95% ethanol is used for DNA precipitation not for DNA digestion and while we…

Q: alphabetical index of your manuals. Why is this such an important rule to follow?

A: ICD-10-CM is International Classification of diseases, Tenth revision, and CM stands for clinical…

Q: How yeast produces natural rare molecules (method)

A: Yeast  are fungi ,which are unicellular in nature. Saccharomyces cerevisiae is the scientific name…

Q: Question 5. You are interpreting data on a DNA chip, or microarray. You expose the chip to a mixture…

A: A microarray is a collection of probes or oligos attached to a chip. Microarray is employed to…

Q: Define electron-transport chain

A: In physiology, the term electron-transport chain refers to the chain of complex structures made up…

Q: What would be the effect on the PCR reaction if any of the following circumstances arose: 1) there…

A: Polymerase Chain Reaction is a laboratory technique to make millions of copies of a particular…

Q: Name the heel bone.

A: The calcaneus, also called the heel bone, is a large bone that forms the foundation of the rear part…

Q: Question 11 In a molecule of double-stranded DNA, the amount of Adenine present is always equal to…

A: DNA is a double stranded helical structure comprised of several nucleotides joined end to end.…

Q: Explanation of why mutations vary in likelihood of causing disease depending on location relative to…

A: Phenylketonuria is caused due to a genetic mutation in the PAH gene( phenylalanine hydroxylase…

Q: Which of the following are true about ddNTPs. Select all that apply. They cause DNA synthesis to…

A: Dideoxynucleotides are nucleotides that lack a 3'-OH group, which helps in the termination of DNA…

Q: 11. Why does Vincent tell Irene. "You are the authority of what is not possible"? How does Vincent…

A: The concept of Gattaca is simple and brilliant: in the near future, genetic engineering enables…

Q: Probabilistic genotyping software allows for unbiased interpretation of a DNA profile using a(n)…

A: Probabilistic genotyping software allows for unbiased interpretation of a DNA profile using…

Q: Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger…

A: CRISPR/Cas9 technology is used to edits genes by precisely cutting DNA and then letting natural DNA…

Q: "If a DNA molecule has 12% thymine, how much guanine will it have?" 12% 24% 38% 76%

A: Chargaff rule: According to this rule in a DNA molecule, the base pairing is complementary and it…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: Nucleic acid are the macromolecule which carries genetic instructions . Instructions vare passed on…

Q: In BCI, in your opinion which part of the operation is the hardest one ? * Signal acquisition…

A: In BCI following parts are signal acquisition, extraction, translation, device output comands. So…

Q: Why is the DNA yield higher from 1g of strawberry compared to 1gof Arabidopsis leaves when both…

A: Ultraviolet spectroscopy is used for the quantification of nucleic acids (DNA, RNA) and protein. The…

Q: Please explain briefly why the use of DNA analyses for identification of plant species is still in…

A: Forensic science, often known as criminalistics, is the application of science to criminal science…