Can you answer the question?

Q: when you're done, use the answer key to check and revise your work. braw a line from each statement…

A: A cell is the basic or fundamental unit of any life form. Living organisms are broadly classified…

Q: 1a) Biliverdin is a pigment produced by tree frogs that causes them to look green - its structure in…

A: Charge of a molecule can be determined with the help of pKa of ionizable groups and PH of the…

Q: From the choices below, which are reputable sites that can be used to locate scientific journal…

A: Science is a term which is used for the study of the subject which is based on the facts and…

Q: A biologist gathered data to show the interaction of the golden-cheeked warbler and juniper tree…

A: It is given that the bar colored in light grey gives the number of juniper tree person acre and the…

Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: Looking at this diagram explain the order of size dependent recruitment of motor units during muscle…

A: Car rental refers to the performance of additional vehicles to achieve increased contraction…

Q: In hyenas, long manes (a) are recessive to short manes (A) and having round ears (b) is recessive to…

A: GIVEN- 1. Short manes is a dominant trait and is designated by A. 2. Long manes is a recessive trait…

Q: Which of the forest(s) would have the greatest species diversity as measured by the Shannon-Wiener…

A: Shanon-Wiener Diversity Index was proposed by Claude E Shanon and Norbert Weiner. The formula was…

Q: Lab 11: Osmosis and Diffusion - Additional Resources. Bio 104 - McCabe C. Effect of Osmosis on Plant…

A: Elodea is a genus of five or six species of submerged aquatic plants of the frog's-bit family…

Q: The photomicrograph below shows mitotically dividing cells from whitefish (Coregonus lavaretus). a.…

A: Mitotic division: it is also known as equal division because each daughter cells have a copy of…

Q: Can you please answer this question

A: Green plants synthesis their own food and that is why they are called autotrophs. The process by…

Q: rue or false: Nursing care is considered an institu- ervice.

A: Caring in nursing It is an action or activities towards providing care.  Factors influencing caring,…

Q: Let's take a closer look at the mandible, which is the only moveable bone in the skull. A process is…

A: Mandible is also called the lower jaw or lower jaw bone. It is the only movable bone in the human…

Q: 4. O.. What is the difference between reductionism as a way to learn and reduction as a c concept?…

A: Molecular biology is the study of the content, structure, and interactions of cellular molecules –…

Q: Directions: Read the paragraph and answer the questions. Write your answer on a separate paper.…

A: Answer 1- the mothers of 3 and 6 are carrying the gene of haemophilia as recessive alleles. They do…

Q: he first organisms on earth were

A: An organism is a personal variety of life that's capable of growing and reproducing and has one or…

Q: b. Connective c. Muscle 8. What are 2 functions of connective tissue? a. Epithelial 7. How many…

A: The human body is a sophisticated, meticulously planned system composed of distinct cells which…

Q: low did doubling the rabbit population affect the grass, snakes, and hawks at first? low did halving…

A: Individuals make up a population,populations make up a species, multiple species and their…

Q: Write the full reaction of the only fermentative reaction that occurs in humans - specifically the…

A: Respiration is the process by which molecules such as glucose are metabolized to yield energy. The…

Q: Explain the feedback mechanism of the action of ADH. Copyright © McGraw-Hill Education. Permission…

A: The urinary system is used to eliminate the waste substances from the body. A pair of kidneys, two…

Q: Which procedure should have been performed to prevent error in this investigation?

A: The correct answer is d, Both groups should have been tested in the same soil type at each humidity…

Q: 5) A patient goes to a doctor complaining of fatigue, muscle weakness, dizziness, and low blood…

A: Adrenal gland: They produce hormones like testosterone, aldosterone, and adrenaline that the body…

Q: 4. A researcher suggests that small doses of hyaluronic acid (HA) will promote the uptake of water…

A: A hypothesis is an assumption that is made based on some evidence.

Q: During the immunohistochemistry (IHC) practical you incubated a section of a chick knee joint with…

A: Introduction  Enzymes are biological catalysts, which means they are specialized proteins that speed…

Q: 4)In 2018, the atmospheric concentration of CO2 was 408 pm, and the concentration of methane was…

A: Parts per billion (ppb) is a unit of measurement used to express the concentration of a substance in…

Q: stop codon. C Chr1 Bace2 180 180 Exon 1 Exon 2 Exon 3 Exon 5 Exon 7 Exon 9 Exon 4 Exon 6 Exon 8 200…

A: Nucleotides in DNA are arranged in exons or introns. Exons are the coding sequence whereas introns…

Q: 1. =lemg/ The order is for 200 mg. The label reads 250 mg/5ml. You would give ml The order is for…

A: Given: Order for 200 mg, Label: 250 mg/5ml. To Find: Amount in ml.Given: Order for 500 mg, Label: 1…

Q: The Kudzu plant is an invasive species because: O It is native to East Asia but currently is found…

A: Introduction: Kudzu (also Known As Japanese Arrowroot Or Chinese Arrowroot) Is A Perennial Vine That…

Q: 1. How is the cell membrane similar to a plastic bag with tiny holes? 2. What two components make up…

A: The extracellular and intracellular environment is aqueous and polar. The cell membrane creates a…

Q: nswer any three.

A: As we know Hemoglobin is a product made from heme+globin. The presence of heme gives the red color…

Q: X-Linked Recessive Disorder: Color Blindness 3. Color blindness is an X-linked recessive disorder in…

A: An individual who suffers from color blindness is unable to distinguish between red and green…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: I’m having hard time grasping the question can you please help answer this question?

A: Ash is a huge reservoir of nutrients. It acts as an additional factor in fastening the growth of…

Q: scharged through the lungs during exhalation is produced from O the Krebs cycle. O Glycolysis. the…

A: Respiration is mainly defined as a biochemical process that occurs in the living cell of an…

Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…

A: This question is about interpreting a scatter plot with a regression line from an experiment that…

Q: Case 2: A phlebotomist name Sarah is in the process of collecting a pro time and CBC from a patient.…

A: Phlebotomist should be educated and well trained in phlebotomy, to avert unessential hazards of…

Q: SQ_LESSON 4_DIFFERENTIATE AEROBIC AND ANAEROBIC RESPIRATION_WHAT'S NEW? What's More Directions: Fill…

A: In Aerobic respiration complete oxidation of glucose into CO2 and H2O takes place. In anaerobic…

Q: The collar bone is ___________ to the arms. Inferior Superior Lateral

A: Introduction Bones give structure to our body. In adult there are 206 bones are present. Bones along…

Q: 1. Divide orchiopexy into its two word parts and give the meaning of each word part. Meaning Word…

A: Orchiopexy: The undescended testicles do not cause pain, but they may cause swelling or a lump in…

Q: 5.How does the simulation model natural selection?

A: Introduction Evolution is the change of biological populations' heritable features across…

Q: Viceroy butterflies and Monarch butterflies look similar in their bright coloration. Scientists have…

A: Viceroy butterflies and Monarch butterflies look similar in their bright coloration. Scientists have…

Q: A student measure soil nitrate (NO3-) concentrations everyday for a week. He wants to use these data…

A: Nitrification and Denitrification are the two process of Nitrogen cycle.

Q: the base of the skull is the foramen magnum. This is where the spinal cord connects to the brain.…

A: The bones of the skeleton, which form the main longitudinal axis of the body in humans and other…

Q: Draw a picture of a DNA replication bubble. • Indicate the origin of replication, the leading and…

A: Since you have posted a question with multi subparts, we will solve the first three subparts for…

Q: a. Place an X on the medicine cup below to indicate what the patient should receive per dose. 30 mL…

A: 10. Phenobarbital is used for controlling seizures.It is used for the relief of anxiety as well.It…

Q: DIRECTIONS: 1. On the cholesterol molecule, label the region that would be embedded in the membrane…

A: Note: As per the Bartleby guidelines I am answering the first three questions, please ask others…

Q: SPELLING EXERCISE Read each medical word pronunciation and write the medical word that it…

A: Pronunciation is the way in which a word or a language is spoken. This may refer to generally…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: The given strand represents the complimentary strand of DNA. The complimentary strand. Given the…

Q: Could you please help answer this question?

A: When hemoglobin is 50% saturated with oxygen, then the oxygen tension developed is called as the P50…