7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a different way you can determine reading frame. a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species. The sequences are aligned but the reading frame is unknown. What is the reading frame for these sequences? (ie., Does the first complete codon begin at the first, second, or third nucleotide?) Hint: Think about what you know about the nature of mutations, natural selection and the genetic code. 1. Bear CCTGAAGAGCTACCTCCG CTCCCTG C G G C C G GAGGCTGAGAATAACCCC GG CCGCCCT CCTGAAGAGCTACCTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTG GCC G C CCT 2. Human 3. Chicken 4. Cow CTTGAAAAGCTACCTACGCTCTCTGAGACCCGACGCTGAGAATAACCCTGGTCGTCCA CCTGAAGAGTTACCTCCGTTCCCTG C G G CCT GAGGCTGAGAATAACCCCG GCC GCCCT

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: Batten disease is also known as neuronal ceroid lipofuscinoses. Batten disease is an autosomal…

Q: by Transcription Factor IID (TF IID)

A:

Q: The following DNA sequence has been determined from DNA isolated from a bit of prehistoric amber…

A: Here, a DNA sequence given and we are asked to write the polypeptide formed from this sequence. In…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…

Q: a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: C<-> A, G   G<-> C,T   CGG transversion are the following   1 ACC   2 ACT   ЗАТТ   4 ATC…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner…

A: Proteins are an important organic compound. Some proteins stimulate the expression of a gene bind to…

Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…

A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: Some evidence suggests that synonymous codons are not really synonymous. Sometimes mutations that…

A: Groups of three nucleotides represent all 20 amino acids. Each nucleotide triplet is called a codon.…

Q: None

A: Thes images is only for reference purposes

Q: 1. Using the data available describe the phenotype that you observe when each of these three genes…

A: The question is related to the use of RNA interference (RNAi) to study the function of specific…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: tRNA possess a set of three nucleotides known as an anticodon. The anticodon of tRNA binds to one or…

Q: that the

A: Polypeptides, or proteins, are chemical compounds composed up of amino acids. They're big,…

Q: A disease in frogs which causes their tongue to fall out of their mouths is killing the frog…

A: Mutations are sudden changes that occur in the genetic sequence of an individual. There are various…

Q: 4) The fact that splicing is a strategy to optimize the use of the genome in eukaryotes is evidenced…

A: Splicing: The biological process of splicing converts a freshly synthesized pre-mRNA into an adult…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: 6) The C-terminal domain (CTD) of yeast RNA polymerase II (RPB) subunit RPB1 contains the repeating…

A: RNA polymerase: it is the enzyme involved in transcription of genetic material, DNA.

Q: Has mutated terminal sequences and lacks a functional transposase or reverse transcriptase. Has…

A: Transposable elements (TEs) are DNA or RNA sequences that have the ability to relocate within a…

Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…

Q: . By inspecting Table 4.5, discuss how the genetic code has evolved to help minimize the impact of…

A: A genetic code is a set of three nucleotide bases that is used to translate information encoded in…

Q: C a 3' 5' exon intron exon intron exon intron untranslated region (UTR) coding sequence (CDS) Label…

A: Genes are the hereditary unit of an organism. It is inherited by the progeny from the parental…

Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…

A: We know that the amino acid sequence of a polypeptide synthesized with respect to an mRNA is based…

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: CRISPR is a DNA sequence that found in prokaryotic organism's genome like bacteria , archaea.…

Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…

A: A frameshift mutation in a gene is when nucleotide bases are added or removed in increments that are…

Q: 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the…

A: Introduction  DNA (Deoxyribonucleic acid) sequence is the order of nucleotide bases (adenine,…

Q: . Let’s say that you have incredible skill and can isolate the white and red patches of tissue from…

A: Mutation It can occur due to errors in DNA copying during cell division, ionising radiation…

Q: The coding sequence of genes that specify proteins with the same function in related species…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…

A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…

Q: What are the amino acids encoded by gene Z?

A: Given information The promoter is from the 20-55th position in the sequence. The ribosome binding…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.