Molecular Genetics Review

docx

School

Sheridan College *

*We aren’t endorsed by this school

Course

BIOLOGY192

Subject

Chemistry

Date

Jan 9, 2024

Type

docx

Pages

Uploaded by SargentSquirrelPerson71

name: __________________________________ Review for Molecular Genetics Unit Test Below is a list of terms and concepts that we covered so far in this unit. You should be familiar with these terms and concepts for the quiz. 1. 5’ cap 2. adenine 3. amino acid 4. anticodon binds 5. antiparallel 6. anti-sense strand 7. base-pair insertion/deletion 8. base-pair substitution 9. codon 10. complementary base pairing 11. cytosine 12. deoxyribose 13. DNA 14. DNA ligase 15. DNA polymerase I 16. DNA polymerase III 17. double helix 18. elongation 19. exons 20. frameshift mutation 21. GTP 22. guanine 23. helicase 24. hydrogen bonds 25. initiation 26. initiator tRNA 27. introns 28. lagging strand 29. large subunit binds 30. leading strand 31. missense mutation 32. mitosis 33. mRNA 34. mutagens 35. mutation 36. nitrogenous base 37. nucleotides 38. Okazaki fragments 39. operator 40. operon 41. P site & A site 42. peptide bond 43. peptidyl transferase 44. phosphate group 45. phosphodiester 46. poly-A tail 47. polypeptide 48. polysome 49. primase 50. promoter 51. promoter region 52. R Type pneumoniae 53. release factor protein 54. repressor protein 55. ribose 56. RNA 57. RNA polymerase 58. rRNA 59. S Type pneumoniae 60. semi-conservative 61. small subunit 62. spliceosomes 63. SSBPs 64. start codon 65. template strand 66. termination 67. termination region 68. The Central Dogma 69. thymine 70. transcription 71. transformation 72. translation 73. tRNA 74. trp operon Below is a list of scientists that we covered in this unit. For the unit test, you should be familiar with the contributions these people made towards the discovery of the structure and/or function of DNA. This will be tested in the Thinking and Inquiry section. 1. Alfred Hershey 2. Erwin Chargraff 3. Francis Crick 4. Fredrick Griffith 5. James Watson 6. Martha Chase 7. Maurice Wilkins 8. Rosalind Franklin 1

Knowledge & Understanding ____ 1. If the percentage composition of guanine in a DNA molecule is 17%, what is the percentage composition of adenine? 66% 17% 33% 34% ____ 2. Base pairing due to hydrogen bonding is fundamental to i) DNA replication ii) transcription iii) translation i and iii only i and ii only i, ii and iii ii and iii only ____ 3. DNA acts as a template for transcription. Which of the following statements regarding the DNA of a gene being expressed is true? After unwinding, only one of the DNA strands acts as a template. The strand with the higher cytosine-guanine content acts as the template. After unwinding, both of the DNA strands act as templates. The two strands only act as a template when paired. ____ 4. Frederick Griffith discovered transformation of bacteria virulence base complementarity the structure of DNA ____ 5. Removing a gene from one organism so that it can be inserted into a plasmid requires restriction enzymes TAQ polymerase single stranded binding proteins nucleiside triphospahtes ____ 6. During the polymerase chain reaction, heat is used to create RNA primers break covalent bonds anneal DNA primers to single-stranded DNA ____ 7. The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology because these enzymes cut DNA at specific and predictable sequences of bases leaving ‘sticky ends’ cut DNA at particular sequences leaving sticky ends tag DNA so that individual fragments can be identified splice DNA fragments together 8. Describe the process by which DNA is replicated in E. coli . (7) 9. Describe the process by which RNA is made in the nucleus (7) 10. Describe the process by which polypepetides are made in the cytoplasm. 11. Describe the structure of a nucleotide 2

Communication 14. (a) Transcribe the following gene into mRNA: ACT CGT TAC GTT CAA CCA ATC TAG CCC AGT GG .................................................................................................................................... (1) (b) Write out the amino acid sequence that would be translated based on the above mRNA transcript: UUAUUUUGCCCGUUGUGGUGGGGCGUGA 3

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

.................................................................................................................................... 1. (3) How is the structure of a purine different from that of a pyrimidine ? 2. Explain the Chargaff’s rule . 3. What is meant the complementary base-pairing ? Describe the hydrogen bonding between nitrogen bases. 4. The two strands of a DNA molecule are antiparallel . What does this mean? 5. Explain the semi-conservative model of DNA replication. 6. When does DNA replication begin ? What is a replication bubble ? 7. Complete the chart to summarize the important enzymes involved in DNA replication . Enzymes Function Helicase Single Strand-Binding Proteins Topoisomerase II DNA polymerase III RNA primase DNA polymerase I DNA ligase 8. Explain how DNA polymerase III works. 9. Why are RNA primers needed during DNA replication? 10. Explain how the leading and lagging strands created during DNA replication are similar and different . 11. What is the end product of DNA replication? 12. What are two types of errors that can occur during DNA replication ? 13. Describe two mechanisms that can correct the errors that occur during DNA replication. 14. In your own words, describe why the lagging strand created during DNA replication will be shorter than the parent DNA strand. Explain how telomeres help correct this problem. 15. Describe three ways DNA replication is different in prokaryotes compared to eukaryotes . 16. How are the processes of transcription and translation related ? 17. What is the Genetic code ? What relationship does a codon play in the Genetic code? 18. What is the function of mRNA ? 19. The Genetic code is said to be redundant . What is mean by this? 20. What is the difference between the template and coding strand of DNA during transcription ? 21. What happens during the initiation stage of transcription ? Explain the importance of the promoter region . 22. Explain how RNA polymerase works. 23. Describe the similarities and differences between DNA polymerase III and RNA polymerase . 24. How is transcription different from DNA replication ? 4

25. What happens during the termination stage of transcription ? 26. What are 3 modifications that mRNA undergo in the nucleus before it enters the cytoplasm? 27. What is the difference between introns and exons ? 28. What is the function of tRNA ? 29. What is an anticodon ? 30. How is translation initiated and terminated ? 31. In your own words, describe the role of each of the three binding sites for tRNA in a ribosome during the elongation stage of translation? 32. The following DNA sequence is a fragment from the template strand that codes for a protein: 3’-AATCCTAGGCCA-5’ a) Write the complementary coding strand b) Write the nucleotide sequence of the mRNA strand transcribed c) Write the anticodon sequence. d) What is the amino acid sequence of the polypeptide strand produced from the mRNA strand? 33. The following DNA sequence is a fragment from the template strand that codes for a protein: 3’-CCGAATGGCAATACT-5’ a) Write the complementary coding strand b) Write the nucleotide sequence of the mRNA strand transcribed c) Write the anticodon sequence. d) What is the amino acid sequence of the polypeptide strand produced from the mRNA strand? 5